ID: 1017994239

View in Genome Browser
Species Human (GRCh38)
Location 6:159518303-159518325
Sequence ACATTGCAACTAAGAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017994239_1017994241 6 Left 1017994239 6:159518303-159518325 CCTAGTTCTCTTAGTTGCAATGT No data
Right 1017994241 6:159518332-159518354 GTTCATGTGAGATACTTCTAAGG No data
1017994239_1017994242 17 Left 1017994239 6:159518303-159518325 CCTAGTTCTCTTAGTTGCAATGT No data
Right 1017994242 6:159518343-159518365 ATACTTCTAAGGTTTTGATGTGG No data
1017994239_1017994243 18 Left 1017994239 6:159518303-159518325 CCTAGTTCTCTTAGTTGCAATGT No data
Right 1017994243 6:159518344-159518366 TACTTCTAAGGTTTTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017994239 Original CRISPR ACATTGCAACTAAGAGAACT AGG (reversed) Intergenic