ID: 1017994243

View in Genome Browser
Species Human (GRCh38)
Location 6:159518344-159518366
Sequence TACTTCTAAGGTTTTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017994238_1017994243 19 Left 1017994238 6:159518302-159518324 CCCTAGTTCTCTTAGTTGCAATG No data
Right 1017994243 6:159518344-159518366 TACTTCTAAGGTTTTGATGTGGG No data
1017994239_1017994243 18 Left 1017994239 6:159518303-159518325 CCTAGTTCTCTTAGTTGCAATGT No data
Right 1017994243 6:159518344-159518366 TACTTCTAAGGTTTTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017994243 Original CRISPR TACTTCTAAGGTTTTGATGT GGG Intergenic
No off target data available for this crispr