ID: 1017994903

View in Genome Browser
Species Human (GRCh38)
Location 6:159523500-159523522
Sequence TGCCATGACCTTAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017994903_1017994909 -8 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994909 6:159523515-159523537 TCATGGCATCTCTAAATTCAAGG No data
1017994903_1017994915 27 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994915 6:159523550-159523572 CTGGGGGAACATTTGTTGAGAGG No data
1017994903_1017994910 8 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994910 6:159523531-159523553 TTCAAGGTTTCTAAGCCATCTGG No data
1017994903_1017994916 28 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994916 6:159523551-159523573 TGGGGGAACATTTGTTGAGAGGG No data
1017994903_1017994913 11 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994913 6:159523534-159523556 AAGGTTTCTAAGCCATCTGGGGG No data
1017994903_1017994911 9 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994911 6:159523532-159523554 TCAAGGTTTCTAAGCCATCTGGG No data
1017994903_1017994912 10 Left 1017994903 6:159523500-159523522 CCCACCCCCTTAAGGTCATGGCA No data
Right 1017994912 6:159523533-159523555 CAAGGTTTCTAAGCCATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017994903 Original CRISPR TGCCATGACCTTAAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr