ID: 1018006937

View in Genome Browser
Species Human (GRCh38)
Location 6:159631108-159631130
Sequence CAGGAAAAACACAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018006929_1018006937 -2 Left 1018006929 6:159631087-159631109 CCAGGCATTGTGTCCACATCCCA No data
Right 1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018006937 Original CRISPR CAGGAAAAACACAATGGGGA AGG Intergenic
No off target data available for this crispr