ID: 1018007294

View in Genome Browser
Species Human (GRCh38)
Location 6:159634262-159634284
Sequence ATGGAGAAACACCCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018007289_1018007294 2 Left 1018007289 6:159634237-159634259 CCTGTAAGGGAGGAAGCAGAGGC No data
Right 1018007294 6:159634262-159634284 ATGGAGAAACACCCTGGGGCAGG No data
1018007287_1018007294 10 Left 1018007287 6:159634229-159634251 CCAGCTGGCCTGTAAGGGAGGAA No data
Right 1018007294 6:159634262-159634284 ATGGAGAAACACCCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018007294 Original CRISPR ATGGAGAAACACCCTGGGGC AGG Intergenic
No off target data available for this crispr