ID: 1018012675

View in Genome Browser
Species Human (GRCh38)
Location 6:159685966-159685988
Sequence ATGGAGGCGTAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018012675_1018012682 8 Left 1018012675 6:159685966-159685988 CCCTCCTTCTTCTACGCCTCCAT 0: 1
1: 0
2: 1
3: 40
4: 585
Right 1018012682 6:159685997-159686019 AAAGTCATTGTTCTTCTCCAAGG 0: 1
1: 0
2: 2
3: 23
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018012675 Original CRISPR ATGGAGGCGTAGAAGAAGGA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900272231 1:1796916-1796938 GTGGAAGCGTAGGAGAAAGATGG + Intronic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
903367597 1:22814732-22814754 AGGGAGGCGGGGAAGAAGCATGG + Intronic
903388148 1:22943236-22943258 ATGGAGGCTTTTAAGAAGGGTGG - Intergenic
903453336 1:23470136-23470158 ACTGAGGCATAGAAGGAGGAAGG - Intronic
903670277 1:25031285-25031307 ATGGAGGCTGAAAAGATGGAGGG + Intergenic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904264312 1:29309691-29309713 ATGGAGGCATAGAGAAATGAAGG + Intronic
904353167 1:29922076-29922098 ATGGAGGCAGTGCAGAAGGATGG - Intergenic
905228223 1:36493731-36493753 ATGGATGCGTAGATGATGGATGG - Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
907238023 1:53064591-53064613 AGGTAGGACTAGAAGAAGGAAGG - Intronic
907712000 1:56892035-56892057 TTGCAGGAGTAGAAGAAGCAAGG - Intronic
908013720 1:59810138-59810160 ATGAAGGCATAAAAGAAGGGAGG - Intergenic
910483550 1:87684659-87684681 ATGCAGGCGCAAAAGAAGCACGG + Intergenic
910770320 1:90824333-90824355 TTTGAGGTGGAGAAGAAGGAAGG - Intergenic
911091130 1:94018073-94018095 ATGAAGGGGTAGAAGATGGTAGG - Intronic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
911644776 1:100326550-100326572 AGGAAGGAGAAGAAGAAGGAAGG - Intergenic
911718755 1:101166815-101166837 TTGGAGGCTTTGAAGAAGCAGGG + Intergenic
912650682 1:111436008-111436030 ATGGAAGAGTAGAGGAAGGGAGG + Intergenic
912675713 1:111679232-111679254 ATGGAGGGCTAGCAGAAGCAGGG + Intronic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
914351262 1:146842578-146842600 ATGGATGAGTAGATGATGGATGG + Intergenic
915646570 1:157276982-157277004 TTGGAGGAGTAGAAGAAAGTTGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916945075 1:169718229-169718251 ATGGAGGCGTAGGCTAGGGAAGG - Intronic
917009849 1:170458374-170458396 ATGGAGGGTTAGATGAAGCAGGG - Intergenic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
917790439 1:178495873-178495895 AGGGAGGCAGAGAAGAATGAAGG + Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918985044 1:191614277-191614299 ATGGTGGCTTAGATGAAGGAAGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919973695 1:202597208-202597230 TTGGAGGGGGAGAAGAGGGAAGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
921032699 1:211347603-211347625 ATGGATGGGGAGAGGAAGGATGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
922595903 1:226812693-226812715 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
922817973 1:228464515-228464537 ACCAAGGCGCAGAAGAAGGACGG - Intergenic
923673555 1:236062255-236062277 ATGGTGGGGAAAAAGAAGGAGGG - Intronic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
1063100129 10:2943006-2943028 ATGGAGGGGGAGCTGAAGGATGG + Intergenic
1063236066 10:4117752-4117774 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1064688190 10:17886331-17886353 AGGGAGGGAAAGAAGAAGGAAGG - Intronic
1064778836 10:18810723-18810745 ATGGGAGCGGAGAGGAAGGATGG - Intergenic
1065302362 10:24334410-24334432 ATGGAGGGGTGGAGGAGGGAGGG + Intronic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065998129 10:31078954-31078976 ATGGAGGCCTAGAGAAGGGAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1072244873 10:93534501-93534523 ATGGAGGGGTTGAACAAGGCAGG - Intergenic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1074041614 10:109795311-109795333 ATGGTGGCTGAGAAAAAGGAAGG - Intergenic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077268591 11:1664680-1664702 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1077321745 11:1946005-1946027 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1079944621 11:26726216-26726238 ATAGAGAGGGAGAAGAAGGAAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083259954 11:61517521-61517543 ATGGAGGGGTGGAGGAAAGAAGG + Intronic
1084441796 11:69178882-69178904 AGGGAGGCAAAGAGGAAGGAGGG + Intergenic
1084457400 11:69275988-69276010 ATGGAGGTGGAGAAGACTGAGGG + Intergenic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1084667819 11:70585921-70585943 ATGGAGGAATGGATGAAGGATGG - Intronic
1085708146 11:78805265-78805287 ATGCAGGGGGAGAAGAAGCATGG - Intronic
1086031845 11:82368715-82368737 GAGGAGGGATAGAAGAAGGAGGG + Intergenic
1086129116 11:83382833-83382855 ATGGAGGGCAAGAAGAAGCAGGG + Intergenic
1086528422 11:87755932-87755954 ATGGATGGGTAGATGATGGATGG + Intergenic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088799662 11:113293920-113293942 AGGGAGGCAGAGAAAAAGGATGG + Intergenic
1089085778 11:115815708-115815730 CTGGAGGCATGGGAGAAGGAGGG + Intergenic
1089906599 11:122046435-122046457 AAGGAGGGGTGGAAGAAGGCTGG + Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090077776 11:123590412-123590434 ATGGAGGCGTGGAGTAGGGAGGG - Intronic
1090276379 11:125422623-125422645 ATGGAGGCGCTGAAAAGGGAAGG + Intronic
1091166598 11:133481826-133481848 ATGGAGGAGTACAGGAAGGAGGG + Intronic
1202804763 11_KI270721v1_random:1318-1340 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1092229773 12:6769982-6770004 ATGAAGGGGAAGAAGAAGGTGGG + Exonic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092693713 12:11144771-11144793 ATGCAGGGGTAGAGGAAGCAGGG - Intronic
1093242511 12:16695573-16695595 AGGGAGGAGGAGGAGAAGGAAGG + Intergenic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093536459 12:20229457-20229479 ATGGAGGGAGAAAAGAAGGAAGG + Intergenic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094449550 12:30570059-30570081 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1095831546 12:46591967-46591989 ATGGAGGGCTAGCAGAAGCAGGG - Intergenic
1096334593 12:50743900-50743922 AGGGAGGCGAAAAAGAAAGAAGG - Intronic
1096642706 12:53006835-53006857 GTGAAGGCGTGGAGGAAGGAAGG + Intronic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097752815 12:63376968-63376990 AAGGTGGGGTAAAAGAAGGAAGG - Intergenic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1100898069 12:99206991-99207013 ATGGACTCTTAGAAGAATGATGG + Intronic
1101117480 12:101546465-101546487 ATGGAGACAGAGTAGAAGGATGG + Intergenic
1101348554 12:103907184-103907206 AGGGAGGGAAAGAAGAAGGAAGG + Intergenic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103245755 12:119455824-119455846 AGGAAGGAGAAGAAGAAGGAAGG + Intronic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104567644 12:129899475-129899497 ATGGATGGGTAGATGATGGATGG + Intronic
1104779297 12:131409610-131409632 ATGGAGGAATAGATGAATGATGG - Intergenic
1105726461 13:23167075-23167097 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1106068915 13:26387730-26387752 GTGGAGACCTAGAAGATGGAAGG - Intronic
1106335172 13:28777171-28777193 ATGGAGGGCTAGATGAAGCAGGG - Intergenic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1108455324 13:50607757-50607779 TGGAAGGCGAAGAAGAAGGAAGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1111086369 13:83380539-83380561 AGGGAGGGGGAGGAGAAGGAAGG - Intergenic
1111467837 13:88640844-88640866 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1112392954 13:99002004-99002026 ATGCAAGCGCAGAGGAAGGACGG - Intronic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113340353 13:109416765-109416787 ATGGAGGGATAGAAGACAGATGG - Intergenic
1113508910 13:110836169-110836191 AGGGAGGGAGAGAAGAAGGAAGG + Intergenic
1114531660 14:23400320-23400342 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114536878 14:23428564-23428586 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114578437 14:23734661-23734683 ATGGAGGGGTAGTAGAGAGAGGG + Intergenic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115020149 14:28669992-28670014 AGGGAGGAGTGGAGGAAGGAAGG + Intergenic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115912775 14:38274925-38274947 ATGGAGGTGGAGAACAAAGAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116010621 14:39347407-39347429 AGGGAGGAGGAAAAGAAGGAAGG + Intronic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116349227 14:43837882-43837904 ATGAAGGAGTAGAAGAGGGGTGG - Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1118009663 14:61596877-61596899 AAAGAGGCAGAGAAGAAGGAGGG + Intronic
1118055771 14:62078072-62078094 ATGAAGGGGGAGAAGACGGAAGG - Intronic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119409978 14:74424578-74424600 ATGGAAGAGGAGAAGAAGGGAGG + Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121692725 14:95889468-95889490 GTGGAGGCGGAGGAGGAGGAGGG - Intergenic
1123058853 14:105585428-105585450 ATGGATGAGTGGATGAAGGATGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1125094848 15:35839206-35839228 ATGGAGGCTGAGAACATGGAAGG - Intergenic
1125492867 15:40161221-40161243 ATGGCGGCGGTGAAGAAGGAAGG + Exonic
1125536171 15:40441929-40441951 AGGGAGGCGCCGAAGACGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126852281 15:52804696-52804718 ATGGAGCCGAAGAAGCTGGAGGG - Intergenic
1127461639 15:59204649-59204671 CTGTAGGGGTAGAAGAGGGAGGG - Intronic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1128121454 15:65150853-65150875 CTGGAGTTGAAGAAGAAGGATGG - Exonic
1128146803 15:65336523-65336545 TGGGAGGAGTAGGAGAAGGAGGG - Intronic
1128345074 15:66848359-66848381 ATCAAGGCGGTGAAGAAGGAAGG - Intergenic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1129949377 15:79572434-79572456 ATGGAGGGATGGAAGAAGGAAGG + Intergenic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130390103 15:83447581-83447603 AGGGAGGCGCAGAGGAGGGAAGG + Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1131915853 15:97265431-97265453 AAGCAGGCTTAGTAGAAGGATGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133711714 16:8408084-8408106 ATGGAGGAATAAAGGAAGGAAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134287966 16:12879084-12879106 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1134833153 16:17339930-17339952 ATGGAGGGATAGATGATGGATGG - Intronic
1134867286 16:17619839-17619861 ATGGAGGGGTAAGAGAAGGAAGG - Intergenic
1134884591 16:17778433-17778455 GTGCAGGTGTAGAAGAAAGAAGG - Intergenic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1137578169 16:49617592-49617614 AGGGAGGGGAAGAGGAAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580075 16:49628194-49628216 ATGGGTGGGTAGATGAAGGATGG - Intronic
1137597150 16:49732000-49732022 ATGGTGGCTTTGAAGAAGCACGG - Intronic
1139813914 16:69651173-69651195 ATGAAGGCAAAGAAGAAGAAAGG - Intronic
1139982774 16:70872968-70872990 ATGGATGAGTAGATGATGGATGG - Intronic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1142128822 16:88423049-88423071 ATGGATGGGTAGATGATGGATGG + Intergenic
1142322492 16:89393095-89393117 ATGCAGGTGAAGAAGAGGGAGGG - Intronic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1143929828 17:10410841-10410863 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143938213 17:10509549-10509571 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143940663 17:10537729-10537751 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143952281 17:10642890-10642912 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1144348913 17:14375555-14375577 ATGGAGGGAGAGAGGAAGGAAGG - Intergenic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147348396 17:39820969-39820991 AGGGAGGCATAGAGCAAGGAAGG - Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147925028 17:43940900-43940922 ATGGAGTCGTAGGAGACAGAAGG + Exonic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148683744 17:49489111-49489133 AGGGAGGCCTAGAACAAGAAAGG + Intergenic
1149000019 17:51747851-51747873 GGGGAGGCATAGAAGAAGGAGGG - Intronic
1149479963 17:56995416-56995438 AGGGAGGGGTAGGAGAAAGAGGG - Intronic
1150320426 17:64209013-64209035 ATGGATGGGTAGATGAATGAAGG - Intronic
1150352668 17:64458127-64458149 AGGCAGGCATACAAGAAGGAAGG - Intronic
1150358354 17:64506957-64506979 AAGGAGGCGTGAAAGAAGGACGG - Exonic
1150822207 17:68444838-68444860 ATGGAGGGAGGGAAGAAGGAAGG - Intronic
1151570881 17:74924693-74924715 AGGGAGGTGTGGAAGAAGGGTGG + Exonic
1152003234 17:77660432-77660454 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152358219 17:79816712-79816734 ATGGAGGCCTGGAGGAATGAAGG - Intergenic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154352644 18:13599032-13599054 AGGAAGGGGTAGAACAAGGAAGG + Intronic
1155040968 18:22065536-22065558 ATGGAGGTGAAGAAGTAAGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155317045 18:24582257-24582279 ATTGAGACGGAGAAGAAGGGAGG - Intergenic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1157482301 18:48063206-48063228 AAGGAGGCGGAGATGAACGAGGG - Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1159322970 18:66877521-66877543 AGGGAGGCGTAGAAGTAGGGAGG + Intergenic
1159719743 18:71873585-71873607 AGGGAGGAGTAAAGGAAGGAAGG - Intergenic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162203314 19:9036997-9037019 ATGGATGAATAGAAGATGGATGG + Intergenic
1163204909 19:15795219-15795241 AAGTAGGCAGAGAAGAAGGAAGG - Intergenic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1164441765 19:28284735-28284757 AGGAGGGTGTAGAAGAAGGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164553532 19:29232494-29232516 ATGGGGGCATGGAAGAAGGCAGG + Intergenic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164678884 19:30121010-30121032 ATGGATGGGTAGATGATGGATGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1165355049 19:35299461-35299483 ATGGAGGTGGACAAGGAGGAGGG + Intronic
1165968452 19:39604698-39604720 ATGGAGGGGTTGGAGAAGAAGGG + Intronic
1167019260 19:46861550-46861572 ATGGAGGGGTGGAAGGGGGAAGG - Intergenic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167689811 19:50978397-50978419 TTGGAGGTGGAGAAGAAAGAGGG + Intronic
1167689828 19:50978487-50978509 ATGGGGGTGGAAAAGAAGGAGGG + Intronic
1167689844 19:50978574-50978596 ATGGGGGTGGAGAAGAAAGAGGG + Intronic
1168522288 19:57061879-57061901 ATGGAGTCTTGAAAGAAGGAAGG + Intergenic
1168646447 19:58062004-58062026 AGGGAGGTGTTGAAGAAGGAGGG - Intronic
925407951 2:3619153-3619175 AGGGAGGCGGGAAAGAAGGAGGG - Intronic
925779524 2:7369609-7369631 GTGGAGGCGGGGAGGAAGGAAGG + Intergenic
925842592 2:8006585-8006607 AGGGAGGAGGAAAAGAAGGATGG - Intergenic
925908088 2:8551504-8551526 ATGAAGGCTTAGAAGTGGGAAGG - Intergenic
926414184 2:12632884-12632906 ATGGAGCCTAAGAAGAAGCATGG - Intergenic
926543243 2:14206804-14206826 ATGGAAGCAAAGAAGTAGGAAGG + Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
927253416 2:21018662-21018684 ATGGAGGGCTAGGAGTAGGAGGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
928277819 2:29919321-29919343 AGGGAGGTGTGGAGGAAGGAAGG - Intronic
929757770 2:44781740-44781762 AGGGAGGCCCAGAAGAGGGAGGG - Intergenic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929926076 2:46210914-46210936 TTGGAGTCCTAGAAGAAGAAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931975350 2:67637996-67638018 GAGGAGGAGTAGAAGAGGGAGGG + Intergenic
933145752 2:78850278-78850300 AATGATGCGTAGAAGAAAGAGGG - Intergenic
933488369 2:82950822-82950844 ATGGAGGGTGAGCAGAAGGAGGG - Intergenic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
935309970 2:101773763-101773785 ATGGAGATATAGTAGAAGGATGG - Intronic
935422764 2:102887000-102887022 AGGGAGGCAGAGAAGAAGGGAGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936481961 2:112892536-112892558 ATGGAGGCATAGAGGAGGCATGG + Intergenic
937075805 2:119105630-119105652 AAGCAGGCATAGAAGATGGAAGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
938275190 2:130014314-130014336 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938326149 2:130405038-130405060 ATGAAGGAGTGAAAGAAGGAAGG - Intergenic
938363790 2:130716421-130716443 ATGAAGGAGTGAAAGAAGGAAGG + Intergenic
938440173 2:131322966-131322988 ATGAAGGAGTGAAAGAAGGAAGG + Intronic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
940572032 2:155448388-155448410 ATGGAGCCCTTGAAGAAGGATGG - Intergenic
940722954 2:157301610-157301632 ATGAAGGTGAAGAGGAAGGAAGG + Intronic
941339349 2:164287127-164287149 AAGGAAGGGAAGAAGAAGGAAGG + Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943857605 2:192818286-192818308 ATGGTGGCATAGAAGCAAGATGG + Intergenic
944812480 2:203341196-203341218 ATGTAGGCGTAAAAAAAGCATGG - Intronic
946032114 2:216713635-216713657 ATAGAAGCCTAGAAGAAGGCTGG + Intergenic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947165314 2:227255663-227255685 AAGGAAGCCTAGAAAAAGGAAGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
948375472 2:237517813-237517835 ATGGATGGGTAGATGAATGAAGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169291440 20:4356627-4356649 CTGGAGGTGAAGCAGAAGGAAGG - Intergenic
1169544328 20:6635246-6635268 AGGGAGGGATAGAGGAAGGAAGG - Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169897775 20:10522733-10522755 ATGGCGGGGAAGAACAAGGAGGG - Intronic
1169914814 20:10674176-10674198 AGGGCGGCGTAGAAGAACCAGGG + Intergenic
1169933187 20:10855979-10856001 ATGGACTGGTAGAAAAAGGAAGG + Intergenic
1170140959 20:13124548-13124570 AGGAAGTCATAGAAGAAGGACGG + Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170803148 20:19606998-19607020 ATGTAGGCATAGAAGAGGGTTGG + Intronic
1170907431 20:20528652-20528674 ATGGTGGGGTAGCAGATGGATGG - Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172589199 20:36105686-36105708 ATAGAGGCTGAGAAGAGGGAGGG - Intronic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1173871527 20:46345034-46345056 ATGGAGGGGTAGATGGATGAAGG - Intergenic
1174158217 20:48531062-48531084 ATGGCAGCCCAGAAGAAGGACGG + Intergenic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174747025 20:53073241-53073263 ATGGAAGGATAGATGAAGGAAGG - Intronic
1174747066 20:53073417-53073439 ATGGAGGGATAGATGAATGAAGG - Intronic
1175273911 20:57754495-57754517 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1175934771 20:62509644-62509666 GTGGAGGGGTGGAAGATGGAAGG - Intergenic
1175935026 20:62510360-62510382 ATGGAGGGGTGGAGGATGGAGGG - Intergenic
1175935195 20:62510815-62510837 GTGGAGGGGTAGAGGATGGAAGG - Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1176358531 21:5973254-5973276 ACTAAGGCGCAGAAGAAGGACGG - Exonic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177214892 21:18115467-18115489 ATGGAGGTGTGGAAAAAAGAAGG - Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178191521 21:30287523-30287545 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1178912250 21:36684589-36684611 ATGGAAGCATAAAAGAAGGGTGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179764987 21:43565296-43565318 ACTAAGGCGCAGAAGAAGGACGG + Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181877638 22:25952488-25952510 ATAGATGAGTAGTAGAAGGATGG - Intronic
1183698765 22:39438072-39438094 ATGGAGGGAACGAAGAAGGAAGG - Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1185018805 22:48361283-48361305 ATGGATGAGTAGATGATGGATGG + Intergenic
1185103701 22:48855388-48855410 ATGGATGGGTAGATGAATGATGG - Intergenic
1185146233 22:49138287-49138309 ATGGATGAGTAGATGATGGATGG - Intergenic
949161395 3:887192-887214 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950635515 3:14311670-14311692 AGGGAGGGATGGAAGAAGGAAGG - Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
951134599 3:19089880-19089902 ATGGAGGGAAGGAAGAAGGAAGG + Intergenic
951349362 3:21586624-21586646 ATGTAGGCTTGCAAGAAGGATGG + Intronic
951526498 3:23657773-23657795 AGGGAGGGAGAGAAGAAGGATGG + Intergenic
951704344 3:25528527-25528549 CTGGAGGAGGAGTAGAAGGAAGG + Intronic
952022881 3:29044069-29044091 AAGGAGGTGAGGAAGAAGGATGG - Intergenic
952056811 3:29457157-29457179 ATGGAGGTGGAGAAGAAGGGAGG - Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
952850656 3:37725819-37725841 CTGGAGGCTTAGAGAAAGGATGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953721954 3:45363919-45363941 GAGGAGGAATAGAAGAAGGAGGG - Intergenic
953834150 3:46328646-46328668 ATGGAGGTGGAGAATATGGAAGG + Intergenic
954254280 3:49393217-49393239 AAGGAAGCGTAAAAGATGGATGG - Intronic
954442150 3:50527744-50527766 ATGCAGGCATTGAATAAGGAAGG - Intergenic
954524861 3:51261257-51261279 ATGGAGGGCAAGCAGAAGGAGGG + Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955292766 3:57707772-57707794 ATGGAGACAGAGTAGAAGGATGG + Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955598548 3:60618855-60618877 AAGGAGGCTTTGAAGAAGGAAGG + Intronic
955874603 3:63476242-63476264 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955874646 3:63476375-63476397 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955874654 3:63476403-63476425 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957652549 3:83027051-83027073 ATGCAGGCTTGGAAGATGGAAGG + Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
958693360 3:97497059-97497081 ACGGAGTGGTAGAAGAAGGGAGG - Intronic
959105831 3:102063539-102063561 ATGGAGGCAAGGAAGAGGGAAGG - Intergenic
959903908 3:111689690-111689712 GTGGAGGGAAAGAAGAAGGAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961688380 3:128650903-128650925 ATGGCGGCGCCGAACAAGGAAGG + Intronic
961911119 3:130317621-130317643 AAGGAGGAGTAGAAGAATTAGGG - Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
965091162 3:164163730-164163752 ATGGAGGGCTAGCAGAAGCAGGG - Intergenic
966059443 3:175736512-175736534 AAGGAAGCTTAGAAGAAGGGAGG + Intronic
966597941 3:181742849-181742871 ATGGGAGGGTAGAAGAAGGGGGG + Intergenic
968292725 3:197551248-197551270 ATGGAGATGTAGTAGAATGATGG - Intronic
968598395 4:1497092-1497114 ATGGATGTGTAGATGATGGATGG + Intergenic
968598421 4:1497265-1497287 ATGGATGTGTAGATGATGGATGG + Intergenic
968598451 4:1497471-1497493 ATGGATGTGTAGATGATGGATGG + Intergenic
969183277 4:5457906-5457928 ATGGAGGGAGAGAGGAAGGAAGG + Intronic
969481298 4:7448470-7448492 AGGGAGACATGGAAGAAGGAAGG - Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970341852 4:15115683-15115705 AGGGAGGAGGAGGAGAAGGAAGG - Intergenic
971425012 4:26507489-26507511 ATGGATGGATGGAAGAAGGATGG + Intergenic
971425030 4:26507567-26507589 ATGGATGCATGGGAGAAGGATGG + Intergenic
971544072 4:27862102-27862124 ATGGTGGCATAGAAGAAAGCAGG - Intergenic
971861168 4:32108088-32108110 AGGGAGGTAGAGAAGAAGGAAGG + Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
972164080 4:36260992-36261014 AGGCAGGCGGAGAAGCAGGATGG - Intergenic
972614018 4:40680887-40680909 ATGGATGAGTGGAAGAAGGCTGG + Intergenic
972924134 4:43983530-43983552 ATGGAGGCAAAAAGGAAGGAAGG + Intergenic
973538589 4:51910249-51910271 ATGGAAGCATATAAGAAAGACGG + Intronic
973563341 4:52159078-52159100 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
973778770 4:54268738-54268760 ATGAAGGTGTACAACAAGGAGGG + Intronic
973779059 4:54271569-54271591 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
974020438 4:56687967-56687989 AGGGAGGTGGAGAGGAAGGAAGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
975403552 4:73964788-73964810 ATGGTTGCTTAGAGGAAGGAAGG + Intergenic
975917664 4:79344090-79344112 ATGGAGGGGTAGGGGTAGGAGGG - Intergenic
976830922 4:89312951-89312973 AGGGAGGCAGAGAGGAAGGAAGG - Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977266731 4:94864427-94864449 GCGGAGGTGTAGAACAAGGAAGG + Intronic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
980190662 4:129520370-129520392 ATAGAGGAGAAGGAGAAGGAAGG + Intergenic
980349393 4:131667063-131667085 ATGGTGGCGTAGGATATGGAAGG - Intergenic
980463961 4:133150766-133150788 GGGGAGGAGTAGGAGAAGGAGGG + Exonic
980620428 4:135294361-135294383 ATGGAGGCATAGAAGCAAGCTGG - Intergenic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
982585382 4:157230590-157230612 ATGGAGGGAAGGAAGAAGGAAGG - Intronic
982618992 4:157679246-157679268 TTGGAGGCCTAGAAGAGGGCAGG - Intergenic
982720525 4:158855058-158855080 AAAGAGGAGTAGGAGAAGGAAGG + Intronic
983500933 4:168499222-168499244 AGGGAGACGGGGAAGAAGGAAGG + Intronic
984762848 4:183377361-183377383 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
984908842 4:184653088-184653110 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
988289721 5:29270183-29270205 ATGGAGGGCTAGCAGAAGCAAGG + Intergenic
988298828 5:29395962-29395984 AGGGCGGCGTAGAAGAGGAAAGG - Intergenic
989535311 5:42556896-42556918 ATGGAGGAGTGAAAGAAGAAGGG - Intronic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990507491 5:56458947-56458969 AAGGAGGGAAAGAAGAAGGAAGG - Intronic
990749918 5:59003408-59003430 TTGGCAGAGTAGAAGAAGGAGGG - Intronic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
991432910 5:66567125-66567147 AGGGAAGCCTAGAAGTAGGATGG + Intergenic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
993628960 5:90260709-90260731 AGAAGGGCGTAGAAGAAGGAGGG - Intergenic
993767588 5:91879907-91879929 ATGGAGACAGAGTAGAAGGATGG - Intergenic
994474274 5:100247743-100247765 TTCCAGGCGTTGAAGAAGGAAGG - Intergenic
995042738 5:107607715-107607737 GTGGAGGGGGAGAGGAAGGAGGG + Intronic
995090236 5:108166362-108166384 TTGCAGGAGTAGAACAAGGAGGG - Intronic
995394761 5:111675765-111675787 ATGGAGGCTGAGGAGATGGAAGG + Intronic
996553596 5:124755097-124755119 ATGGAGGCAAAGGAGAAAGATGG - Intergenic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000417566 5:160998546-160998568 ATGGAGGGCAAGAAGAAGCAGGG - Intergenic
1000547976 5:162625553-162625575 ATGGAGGGCTAGCAGAAGCAGGG + Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1000997626 5:167974422-167974444 AGGGAGGGGTGGAGGAAGGAGGG + Intronic
1002642892 5:180638992-180639014 ATGGAGGGATGGAAGAAGTATGG + Intronic
1002847627 6:961968-961990 GTGGAGGCATAGGAGAGGGATGG - Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1005376567 6:25188462-25188484 ATGGAGGCACAGTAGAAAGATGG - Intergenic
1005458362 6:26043578-26043600 ACTAAGGCGCAGAAGAAGGATGG - Exonic
1005473367 6:26183853-26183875 ACCAAGGCGCAGAAGAAGGACGG + Exonic
1005475051 6:26199616-26199638 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1005476880 6:26216564-26216586 ACCAAGGCGCAGAAGAAGGATGG - Exonic
1005480603 6:26251708-26251730 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1005571128 6:27146719-27146741 ACTAAGGCGCAGAAGAAGGACGG - Exonic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007398455 6:41590315-41590337 AGGGAGGCGTAGGTGAAGGGGGG - Exonic
1008060080 6:46987792-46987814 ATGGAGGTGGAGAGGAATGATGG - Intergenic
1008888382 6:56456556-56456578 AAGGAGGCGGAGGAGAAGAAAGG - Intergenic
1010887374 6:81261575-81261597 ATGGAGGTTTAGGAGGAGGAGGG + Intergenic
1011220643 6:85051315-85051337 ATGGAGGAGTGGAAGAACAAAGG + Intergenic
1011245206 6:85314900-85314922 ATGGAGGGTGAGAAGAAGCAGGG - Intergenic
1011812083 6:91144402-91144424 AGGGAAGCACAGAAGAAGGAAGG - Intergenic
1012305563 6:97653362-97653384 AGGAAGGAGTAGAAGAAGGGAGG - Intergenic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1013325238 6:109039097-109039119 AGGGAGGAGAAGGAGAAGGAAGG + Intronic
1014433089 6:121392043-121392065 TGGGAGGGGTAGAGGAAGGATGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015424413 6:133049321-133049343 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1016572788 6:145533519-145533541 ATGGAGGCAGAGAAGTAGGTGGG - Intronic
1016647068 6:146422995-146423017 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
1016865431 6:148761291-148761313 AGGGAGGCGGAGCAGAAGGCAGG - Intronic
1016890863 6:149005598-149005620 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017994888 6:159523365-159523387 GTGGAGGAGTAGGAGAAGAAGGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018569079 6:165188068-165188090 ATGGAGGCGGAAGAGAAGGAGGG - Intergenic
1018632335 6:165831904-165831926 CTGGAGGAGTAGAAGACGTAAGG - Intronic
1019335977 7:483055-483077 ATGGATGGATAGAAGATGGATGG + Intergenic
1019531685 7:1506557-1506579 GAGGAGGGGGAGAAGAAGGAAGG - Intergenic
1019908591 7:4083640-4083662 AGGGAGGGGTGGAGGAAGGAAGG - Intronic
1022282462 7:28924980-28925002 AGGGAGGGGAGGAAGAAGGAAGG + Intergenic
1023214507 7:37847577-37847599 ACGGAGGAGGAGGAGAAGGAGGG + Intronic
1024107482 7:46107946-46107968 ATGGAGGAGTTGTAGAATGAAGG - Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024471087 7:49769447-49769469 AAGGAGGGAAAGAAGAAGGATGG - Intergenic
1024833378 7:53487690-53487712 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1030469601 7:109947122-109947144 TTGGAGGAGGAGAAGAAGTAGGG - Intergenic
1031697283 7:124874031-124874053 AGGGAAGCGGAGAATAAGGATGG - Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034646192 7:152649954-152649976 ATGGTGGCGTGGAAGACAGAAGG + Intronic
1035278821 7:157764876-157764898 ATGGATGGGTGGATGAAGGATGG - Intronic
1035279080 7:157766008-157766030 ATGGATGGGTGGATGAAGGAAGG - Intronic
1036546121 8:9771460-9771482 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040880299 8:52197721-52197743 AGGGAGGCCAAAAAGAAGGAAGG + Intronic
1041155775 8:54985368-54985390 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041884583 8:62793604-62793626 ATGGAGACGTAGTGGTAGGAGGG + Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043094240 8:75946411-75946433 AGGGAGGGATAGAGGAAGGAAGG - Intergenic
1043412981 8:80018956-80018978 ATGGAGACAGAGTAGAAGGATGG + Intronic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044926657 8:97214906-97214928 AGGAAGGCTTAGAAAAAGGAGGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045298132 8:100889857-100889879 ATGCAGGCCTAGAAGCAGCATGG + Intergenic
1045547338 8:103140687-103140709 TTGGAGGCGGAGAGGAGGGACGG + Intronic
1045711558 8:104990481-104990503 ATGAAGGCATAGATGAAGAAAGG - Intronic
1047261325 8:123263050-123263072 AGGGAGGCTTGGAAGAAGGAAGG + Intronic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048989500 8:139752987-139753009 ATGGATGGGTAGAAGTTGGATGG - Intronic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049439068 8:142601004-142601026 AAGGAGGCCTGGAAGAAGGGGGG + Intergenic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049569558 8:143362793-143362815 ATGGAGGCTCAGAAGACCGAAGG - Intergenic
1050031679 9:1393247-1393269 ATGGAGGGCTAGCAGAAGCAGGG + Intergenic
1050211627 9:3265003-3265025 ATGGAGGTGTGCAAGAAAGAAGG - Intronic
1050610270 9:7344828-7344850 AGGGAGGGGTGGAGGAAGGAGGG + Intergenic
1051814240 9:21087065-21087087 ATGGAGGGTAAGCAGAAGGAGGG + Intergenic
1052395684 9:27935233-27935255 AAGGAGGAATAGAAGAAGCAGGG + Intergenic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1054171334 9:61843155-61843177 ATGGTGGCGTAGGATATGGAAGG + Intergenic
1054666200 9:67737657-67737679 ATGGTGGCGTAGGATATGGAAGG - Intergenic
1055040373 9:71864540-71864562 ATGGAAGCCTAGAGGAAGGAAGG - Intronic
1055708251 9:79031882-79031904 CAGGAGGGGAAGAAGAAGGAGGG + Intergenic
1057726093 9:97569204-97569226 GTGGAAGCGATGAAGAAGGAAGG - Intronic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1059155466 9:111985018-111985040 GTGGAGGGGTGGAGGAAGGAAGG + Intergenic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059768491 9:117405945-117405967 ATGGGTGCTTAGAAGAGGGAAGG + Intronic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060283524 9:122228979-122229001 GGGGAGGAGGAGAAGAAGGAGGG - Intronic
1060493547 9:124101827-124101849 AGGAAGGCGAAGAAGAAAGAAGG + Intergenic
1060956657 9:127646265-127646287 ATGGAAGCTTTGAAGAAAGAAGG - Intronic
1061372966 9:130208163-130208185 ATGTAGGCAGAGAAGAAAGATGG + Intronic
1061500800 9:131000777-131000799 AGGGAGGCATCCAAGAAGGAGGG + Intergenic
1061853550 9:133429442-133429464 ATGGAGGGGTGGATGGAGGAGGG - Intronic
1061861781 9:133472133-133472155 ATGGCCGCGAAGAAGAAGAAAGG + Exonic
1062097843 9:134712059-134712081 AAGGAGGGGTACAGGAAGGAGGG - Intronic
1062097967 9:134712452-134712474 AAGGAGGGGGACAAGAAGGAGGG - Intronic
1185636733 X:1557611-1557633 ATGGATGAATAGAAGATGGATGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1187189974 X:17025097-17025119 AATGAGGCGGGGAAGAAGGAGGG - Exonic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1191675250 X:63785823-63785845 ATGGAGGTTTGGAAGAGGGAAGG + Intergenic
1192451779 X:71249456-71249478 TTGGGGGCGTACAAGAAGGTGGG - Exonic
1192938092 X:75881978-75882000 ATGGAGGGATAGAAGAAAAAAGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1195618407 X:106930628-106930650 AGGGAGGGGTAGGAGAGGGATGG - Exonic
1195870566 X:109481029-109481051 ATGAAGGGAGAGAAGAAGGAAGG + Intronic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196939454 X:120761048-120761070 AGGGAAGGGAAGAAGAAGGAAGG - Intergenic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1198526514 X:137506862-137506884 TTGGAGGAGTGGAAGAGGGAGGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200783796 Y:7240846-7240868 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1201409081 Y:13680666-13680688 ATGGAGGGTGAGAAGAAGTAGGG + Intergenic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic