ID: 1018014517

View in Genome Browser
Species Human (GRCh38)
Location 6:159699888-159699910
Sequence GTTCTCAGTGGACCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018014517_1018014521 23 Left 1018014517 6:159699888-159699910 CCAGATTGTGGTCCACTGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1018014521 6:159699934-159699956 GGGAACCTATGTCCCATCTCAGG No data
1018014517_1018014519 2 Left 1018014517 6:159699888-159699910 CCAGATTGTGGTCCACTGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1018014519 6:159699913-159699935 TATTGATATCACAGTATTTCTGG No data
1018014517_1018014520 3 Left 1018014517 6:159699888-159699910 CCAGATTGTGGTCCACTGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018014517 Original CRISPR GTTCTCAGTGGACCACAATC TGG (reversed) Intronic
904777019 1:32915955-32915977 GATCTCACGGGACCACAATGTGG - Intergenic
905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG + Intergenic
909530970 1:76681415-76681437 CTTCTCAGTGGAGTACAACCTGG - Intergenic
915475956 1:156153007-156153029 GTGCTCACTGGACCACACTTTGG - Intronic
918354220 1:183690980-183691002 AATCTCAGTGAACCCCAATCAGG - Intronic
1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG + Intronic
1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG + Intergenic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1066748960 10:38633222-38633244 GTTCTAAGTGTATGACAATCTGG + Intergenic
1066967704 10:42284563-42284585 GTTCTAAGTGTATGACAATCTGG - Intergenic
1068933968 10:62618295-62618317 GTTCCAAATGGACCCCAATCAGG - Intronic
1072489151 10:95886752-95886774 GGTCTCAGTGGGCTAAAATCAGG - Intronic
1073814706 10:107193791-107193813 GGTCTCACTGGACGAAAATCAGG - Intergenic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1079764937 11:24380457-24380479 GTTCTCTTAGGACCAGAATCAGG + Intergenic
1082685062 11:56228007-56228029 GTCTGCAGTGAACCACAATCAGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1092740383 12:11623064-11623086 GTTCTCAGTGGTGCCAAATCAGG - Intergenic
1108911420 13:55556664-55556686 GTTCTCAGTGGAATACCATGAGG + Intergenic
1109987158 13:70002604-70002626 AATCTCAGTGAACCCCAATCAGG + Intronic
1110517355 13:76430400-76430422 GTTCTCAGTGGAACTAAAACTGG - Intergenic
1111900212 13:94190505-94190527 GTCCTCAGTGTCCCTCAATCTGG - Intronic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG + Intergenic
1119041197 14:71276282-71276304 GTTCTCAGTGGATAACACTTAGG - Intergenic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1121893546 14:97622420-97622442 GTCCTCTTTGGACCCCAATCAGG + Intergenic
1124077808 15:26462276-26462298 GTTCTCTGTGCACCACAGTCAGG - Intergenic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1126804630 15:52334848-52334870 GCTCTCTGTGTACCACAATTTGG - Intronic
1127098312 15:55535539-55535561 GTTCTCTGTGCACCACAGGCAGG - Intergenic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1139148035 16:64345862-64345884 GTTCTCAGGGGACCAGAAGAGGG - Intergenic
1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG + Intergenic
1143742240 17:8963292-8963314 GTGCTCAGTGGAACCCAAGCTGG + Intronic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG + Intergenic
1154121505 18:11656107-11656129 GTTTCCAGTGCTCCACAATCTGG - Intergenic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1158952789 18:62510898-62510920 GATCTCAGTGGTAAACAATCAGG + Intergenic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
934311952 2:91875344-91875366 GTTCTAAGTGTATGACAATCTGG + Intergenic
935036555 2:99381383-99381405 GTGCTCAGTGAACCAGAATGCGG + Intronic
938606624 2:132900055-132900077 GTTCTGAGTGCACCACCAACTGG - Intronic
943536081 2:189152515-189152537 ATTCACAGTGGAACACAGTCAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG + Intergenic
947307684 2:228765327-228765349 GTTCTCTGGGGACACCAATCAGG - Intergenic
1170116971 20:12871007-12871029 ATTCCCAGTGGACCACACACTGG - Intergenic
1172626039 20:36347388-36347410 GTGCTCAGTGGCCCATGATCTGG - Intronic
1172671747 20:36639276-36639298 GTCCTGAGTTGACCACAGTCTGG - Intronic
1173327011 20:42043113-42043135 GTGTTCTGTGGACCACACTCTGG - Intergenic
1173689040 20:44945045-44945067 GTTCTGAGTGGATCACAGTTTGG - Intronic
1177866507 21:26518967-26518989 GTTTGCAGTGGATCACAAACAGG - Intronic
1179447626 21:41444063-41444085 CTTTTCAGGGGACCACAGTCAGG + Intronic
1180538709 22:16421172-16421194 GTTCTAAGTGTATGACAATCTGG + Intergenic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
949096815 3:96192-96214 CTTCTCAGTGGAACACAAGAGGG - Intergenic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
952636349 3:35537360-35537382 GTTGTCAGTGGACTGCCATCAGG + Intergenic
953044129 3:39280392-39280414 GTACTCACTGGACCACACTGGGG + Intronic
955463224 3:59208490-59208512 GGTCTCACTGGACTAAAATCGGG - Intergenic
967388915 3:188936524-188936546 GATCTCAGTGGGCCACTTTCTGG - Intergenic
967697817 3:192553865-192553887 GTTTTCAGTGGTCCCCAACCTGG - Intronic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG + Intronic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
974795219 4:66740355-66740377 TTTATCAGAGGACCACAATCTGG - Intergenic
976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG + Intergenic
984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG + Intergenic
985761018 5:1748810-1748832 GTTCTCAGTGTCCCTCATTCTGG - Intergenic
998986379 5:147762558-147762580 TTTCTCTGTGGTGCACAATCTGG + Intronic
1001542359 5:172548490-172548512 TTTATTAGTGGCCCACAATCAGG - Intergenic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1009467521 6:63990556-63990578 GTTCTCAGTGATCCCCAATGTGG - Intronic
1010825041 6:80462889-80462911 GCTCCCAGTGCATCACAATCTGG - Intergenic
1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG + Intergenic
1012455096 6:99394647-99394669 GTTCGAAGTTGACCTCAATCAGG + Intergenic
1012647942 6:101712238-101712260 CTGCTCAGTGGACCACACACAGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019231947 6:170573791-170573813 GTTCTCTTTGGACTGCAATCTGG - Intergenic
1020326443 7:6978172-6978194 GTTCTCAGGGGACCAGAACAAGG - Intergenic
1026967695 7:74450848-74450870 CTTCTCATTGGACCACAGTGTGG - Intergenic
1028942332 7:96536318-96536340 GTTCTCTGTGGCCCAAAATGTGG + Intronic
1030225597 7:107146829-107146851 GTGTTCAGGGGACCACACTCTGG - Intronic
1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG + Intronic
1038851277 8:31279442-31279464 GTTCTCAGAGGTGCACAATCAGG - Intergenic
1039088245 8:33801010-33801032 TTTCTCAGTGGCCTACAATTTGG - Intergenic
1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG + Intergenic
1050435902 9:5610576-5610598 GTTCTCAGTGAAGCACAGTCTGG + Intergenic
1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG + Intergenic
1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG + Exonic
1185669294 X:1792919-1792941 GTTCTCAGAGGACCCCATCCAGG - Intergenic
1187485831 X:19702464-19702486 TTTCTCAGTGGCCCCCAGTCAGG - Intronic
1190121748 X:47666045-47666067 GTTCTCAGTGGCTAACAACCAGG - Intergenic
1191642396 X:63441633-63441655 CGTCTCAGTGCTCCACAATCAGG - Intergenic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1197480859 X:126984217-126984239 ATTCTAAGTGCACCACAACCAGG - Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic