ID: 1018014520

View in Genome Browser
Species Human (GRCh38)
Location 6:159699914-159699936
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018014518_1018014520 -9 Left 1018014518 6:159699900-159699922 CCACTGAGAACAGTATTGATATC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014515_1018014520 14 Left 1018014515 6:159699877-159699899 CCAGGTCCATGCCAGATTGTGGT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014516_1018014520 8 Left 1018014516 6:159699883-159699905 CCATGCCAGATTGTGGTCCACTG 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014517_1018014520 3 Left 1018014517 6:159699888-159699910 CCAGATTGTGGTCCACTGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014513_1018014520 15 Left 1018014513 6:159699876-159699898 CCCAGGTCCATGCCAGATTGTGG 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014512_1018014520 18 Left 1018014512 6:159699873-159699895 CCACCCAGGTCCATGCCAGATTG 0: 1
1: 0
2: 0
3: 14
4: 306
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data
1018014511_1018014520 27 Left 1018014511 6:159699864-159699886 CCTCGCATACCACCCAGGTCCAT 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1018014520 6:159699914-159699936 ATTGATATCACAGTATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr