ID: 1018014521

View in Genome Browser
Species Human (GRCh38)
Location 6:159699934-159699956
Sequence GGGAACCTATGTCCCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018014517_1018014521 23 Left 1018014517 6:159699888-159699910 CCAGATTGTGGTCCACTGAGAAC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1018014521 6:159699934-159699956 GGGAACCTATGTCCCATCTCAGG No data
1018014518_1018014521 11 Left 1018014518 6:159699900-159699922 CCACTGAGAACAGTATTGATATC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1018014521 6:159699934-159699956 GGGAACCTATGTCCCATCTCAGG No data
1018014516_1018014521 28 Left 1018014516 6:159699883-159699905 CCATGCCAGATTGTGGTCCACTG 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1018014521 6:159699934-159699956 GGGAACCTATGTCCCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018014521 Original CRISPR GGGAACCTATGTCCCATCTC AGG Intronic
No off target data available for this crispr