ID: 1018016048

View in Genome Browser
Species Human (GRCh38)
Location 6:159713297-159713319
Sequence GGGTTTGAAAAGATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018016048_1018016057 29 Left 1018016048 6:159713297-159713319 CCCTGCCTCATCTTTTCAAACCC 0: 1
1: 0
2: 3
3: 29
4: 303
Right 1018016057 6:159713349-159713371 GCCAGCCCCTGGCCTATCACTGG 0: 1
1: 0
2: 1
3: 27
4: 326
1018016048_1018016059 30 Left 1018016048 6:159713297-159713319 CCCTGCCTCATCTTTTCAAACCC 0: 1
1: 0
2: 3
3: 29
4: 303
Right 1018016059 6:159713350-159713372 CCAGCCCCTGGCCTATCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 276
1018016048_1018016055 18 Left 1018016048 6:159713297-159713319 CCCTGCCTCATCTTTTCAAACCC 0: 1
1: 0
2: 3
3: 29
4: 303
Right 1018016055 6:159713338-159713360 ATTACACCTCAGCCAGCCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018016048 Original CRISPR GGGTTTGAAAAGATGAGGCA GGG (reversed) Intronic
901559204 1:10056743-10056765 GGGCTTGAGAAGATGGGGCCTGG + Intronic
902201457 1:14836563-14836585 GGGTCTGGAAAGAGGAGGCGTGG - Intronic
902434646 1:16390370-16390392 GGGCTTGAAGAGATGAGGCCAGG + Intronic
903265315 1:22154457-22154479 GGGCATGATAAAATGAGGCAGGG + Intergenic
906280302 1:44548785-44548807 GGGTTTTAAAGAATGAGGCTGGG - Intronic
907226768 1:52954766-52954788 GGGTTTGAGAAGATGAGTAAGGG + Exonic
907638477 1:56160197-56160219 AGGTTTGGAAGGAAGAGGCAGGG - Intergenic
908386376 1:63646094-63646116 GGGTCTGAAAAGATGAAGAGAGG + Intronic
908700965 1:66899731-66899753 TAGTTTGAAAATATGAGGTAAGG + Intronic
908835614 1:68226686-68226708 GGGTTGGTAAAGAGGAGACATGG - Intronic
909633644 1:77792170-77792192 GGGTTTAAAAAGAGGAGACTTGG + Intronic
910578803 1:88798322-88798344 GAGTTTGAAAACATGAGCAAAGG + Intronic
910626644 1:89314400-89314422 GTGTTTGCTAAGATGAGGCTTGG + Intergenic
911274413 1:95843698-95843720 GGGTCGGTAAAGATGAAGCAAGG - Intergenic
911409177 1:97480570-97480592 GAATGTGAAAAGACGAGGCAGGG + Intronic
913215389 1:116615796-116615818 GGATATGAAAATATAAGGCAAGG - Intronic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
919221477 1:194635135-194635157 GGAGTTGAATAGGTGAGGCATGG - Intergenic
919495968 1:198268406-198268428 GAGATTGAAAAGAAGAGGTAAGG - Intronic
919753178 1:201050928-201050950 GGCTTTGATAAGCTGAGGCATGG - Intronic
920678001 1:208051629-208051651 GGGTTTGAAAATGAGGGGCAGGG + Intronic
920752140 1:208688916-208688938 GGGTCTTAAAAGATGAAGGAAGG + Intergenic
920754671 1:208717707-208717729 GGGCTTTAAAAAATGTGGCAGGG + Intergenic
921350999 1:214234507-214234529 AAAATTGAAAAGATGAGGCAAGG + Intergenic
922755484 1:228094342-228094364 GGGGTTGGAAAGCTGAGGCGAGG - Intronic
923681523 1:236122408-236122430 GGGTTTCAAATGATGAATCAGGG + Intergenic
924413218 1:243829074-243829096 CGGATTGAAGAGATTAGGCAGGG - Intronic
1062831626 10:609493-609515 GGGTTTGAGAAGATGAGCTGTGG - Intronic
1063168238 10:3483210-3483232 AAATTTGAAAAGATTAGGCAGGG + Intergenic
1064198177 10:13262432-13262454 GGGTTTACAAACTTGAGGCAGGG + Intergenic
1064407904 10:15080852-15080874 GAGTTTTAAAAAATAAGGCAAGG - Intronic
1066307804 10:34163384-34163406 GAATTTGAAAAGATGAAGAAAGG + Intronic
1067079022 10:43203287-43203309 GGGCCTGAAAAGGTGAGGCGGGG - Exonic
1068669211 10:59707736-59707758 GGGTTTGAAAGATTGAGGTAAGG + Intronic
1069777977 10:70937871-70937893 GGGATTGAAATGAAGAGTCATGG + Intergenic
1071429456 10:85595219-85595241 GGGGTTGAAAGCAGGAGGCAAGG + Intergenic
1071939237 10:90570276-90570298 GGCTTTGAAAAAATGAGTTAAGG + Intergenic
1073672811 10:105610800-105610822 GGGTTTTAAAAGAAAAGGTATGG - Intergenic
1074585214 10:114761783-114761805 GGGCATGAAAAGAAGTGGCATGG - Intergenic
1074939667 10:118222198-118222220 GGCTTTCAAAAGATGATTCATGG + Intergenic
1075622833 10:123940245-123940267 GGGTAGGTAAAGAAGAGGCATGG - Intronic
1076083658 10:127606169-127606191 GGATGTCAAAAGATGAGGCAGGG + Intergenic
1076148165 10:128141608-128141630 GGGGTTGGGAGGATGAGGCAAGG + Intergenic
1076417128 10:130300147-130300169 GAGTTTGAGAAGACTAGGCAGGG - Intergenic
1078025402 11:7690251-7690273 GGGTTTGGAAAGAAGAATCATGG + Intronic
1079024182 11:16932918-16932940 GGGTAGGAAAAGATGAGGTAGGG + Intronic
1079313772 11:19390331-19390353 GGGATTCAAAAGCTGAGGCAAGG - Intronic
1079334122 11:19556013-19556035 GGCTTTGAAAGGAGGAGGGAAGG - Intronic
1079905657 11:26243824-26243846 GTTTTTGAAAAAATGAGGCCAGG + Intergenic
1080470725 11:32543091-32543113 GAGTGTGAAAAGGTGAGGGAAGG + Intergenic
1080597221 11:33784104-33784126 AGGAAGGAAAAGATGAGGCAGGG - Intergenic
1081506784 11:43725813-43725835 GAGTTTGAATAAATGAGGCTAGG + Intronic
1082799717 11:57405775-57405797 GGATTTCACAAGCTGAGGCAGGG + Intronic
1086125627 11:83345648-83345670 GGGTTTGCAAAGATGAGGGCAGG + Intergenic
1086375784 11:86199503-86199525 TGCTTTGGAAAGCTGAGGCAGGG - Intergenic
1087208929 11:95426433-95426455 AGGTTTGAAAAAAGGAGGAAGGG - Intergenic
1088895783 11:114077343-114077365 GGGTTTGAAAAGATGCCACCTGG + Intronic
1089988212 11:122833352-122833374 GGGTTAGAACAGAAGAGGCTGGG + Intergenic
1090604440 11:128406757-128406779 GGGTTTGGAAAGAGGAAGGAAGG + Intergenic
1091745154 12:2987245-2987267 GGGTTTAAAAAGAAGAGGTCAGG + Intronic
1092148991 12:6234038-6234060 GGATTTGAAAAGGTGGGGCTGGG + Intronic
1092229793 12:6770064-6770086 GGGTTTGAAGACCTGAAGCAGGG + Intronic
1093091401 12:14924993-14925015 TGGTCTGAAAAGGTGAGGCATGG + Intronic
1094014697 12:25849940-25849962 GTGTTAGAAAAGGTGAGACAGGG + Intergenic
1095133115 12:38566942-38566964 GGGCTGGAAAATATGAGACAAGG + Intergenic
1096979628 12:55721001-55721023 TGCTTTGAACAGATGAGCCATGG + Intronic
1097590608 12:61570572-61570594 GGTTTAGAAAAGATAAGGAAAGG - Intergenic
1097754569 12:63395393-63395415 GGTTTTTAAAAGATTAGACAGGG + Intergenic
1098231402 12:68375208-68375230 AGTTTTAAAAAGATCAGGCAAGG + Intergenic
1099213959 12:79831284-79831306 GAGATTGAAAAGAGGAGGCTGGG + Intronic
1099742352 12:86655758-86655780 GGATTTGAAACGAAGAAGCATGG - Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1101023319 12:100574549-100574571 CGGTGTGAAAAGATTAGGAAAGG - Intronic
1101594092 12:106148326-106148348 GGGTTTCAAAGGATGAGGCTGGG - Intergenic
1101596652 12:106172325-106172347 GGGTTTCAAAAGAAGATGCTGGG - Intergenic
1103344793 12:120242023-120242045 GGGATGGAACAGATGAGACAGGG + Intronic
1105219127 13:18309273-18309295 GGATATGAAAATATAAGGCAAGG - Intergenic
1106567570 13:30899633-30899655 GGGTCTTAAAAGATGAGTGAGGG + Intergenic
1109897982 13:68719400-68719422 TGGTCTAAAAAGAGGAGGCATGG + Intergenic
1110328709 13:74246862-74246884 GTGTTAAAAAAGATGAGGGAGGG + Intergenic
1111118611 13:83815656-83815678 AGGTAAGAAAAGATGAGACATGG - Intergenic
1111378081 13:87407364-87407386 GGCTTTGAAAATTTAAGGCATGG - Intergenic
1114553112 14:23545541-23545563 GGTTCTGGAAAGATTAGGCAGGG - Intronic
1114710640 14:24774561-24774583 GGGTATGTAATGATGGGGCAGGG + Intergenic
1115272699 14:31571754-31571776 GGATTTCAAAAGATGAAGAAAGG - Intronic
1115891230 14:38031090-38031112 GTGTTTGACAAGAGTAGGCAAGG + Intronic
1116960276 14:50961740-50961762 GGATATGAAAAGAGAAGGCAGGG + Intergenic
1117105499 14:52393998-52394020 GGGTTGGGAAGGATGGGGCATGG - Intergenic
1117338390 14:54774108-54774130 GGGTTGGAGAAGATGCGGTAGGG + Intronic
1118241315 14:64061221-64061243 GGGTTTGAAAAAATGAAGTGAGG - Intronic
1120304592 14:82752558-82752580 GAGCTAGAAAAGAGGAGGCACGG - Intergenic
1120495532 14:85230179-85230201 TACTTTGAGAAGATGAGGCAGGG - Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1120967853 14:90183473-90183495 GGCTTAGAAAAGATGAAGCAGGG - Intronic
1122117970 14:99537030-99537052 AGGTTTGGAAGGAGGAGGCAAGG + Intronic
1122142921 14:99673516-99673538 GAGTCTGAAAAGAAGAGGAAGGG + Intronic
1122297262 14:100712587-100712609 GGGTTTGCAAACATGAATCATGG - Intergenic
1125436209 15:39647567-39647589 GGGGTAGAAAAGATGTGGAAAGG - Intronic
1125746059 15:41997961-41997983 GAGCTTGGAAAGATCAGGCAGGG - Intronic
1126505050 15:49395665-49395687 TGTTTTGAAAGGCTGAGGCAGGG + Intronic
1126630025 15:50724834-50724856 GGGTTTAAGAATATTAGGCAAGG - Intronic
1126843035 15:52735496-52735518 GGGATTTACATGATGAGGCAGGG - Intergenic
1127255016 15:57282607-57282629 GGGTTTGAAAAGAAACAGCAAGG + Intronic
1129538041 15:76330144-76330166 GAGATGGGAAAGATGAGGCAGGG - Intergenic
1130331267 15:82924096-82924118 GGGTTTGGAAAGAAAAGGTACGG + Intronic
1130865308 15:87928631-87928653 GGGCTGGAACAGATGAGGAAAGG - Intronic
1131015841 15:89057392-89057414 GGGTTTCTGAAGATGAGGTAGGG + Intergenic
1135479154 16:22806924-22806946 AGGTTTGCAAAGAGGAGGGAGGG + Intergenic
1137246463 16:46709930-46709952 GGGGCTGAGAAGTTGAGGCAGGG + Intronic
1137730526 16:50686422-50686444 GGGTTGGAACAGAAGAGCCAGGG - Intergenic
1137830913 16:51542406-51542428 GCTTTTGAAAAGATCAGGCACGG - Intergenic
1139130437 16:64136253-64136275 GGGTTTGAACAGAGGAAGTAGGG + Intergenic
1139439832 16:66960792-66960814 GTGTGTGAAAACATGAGGCTTGG - Intergenic
1140018624 16:71214834-71214856 GGGACTGAAAGAATGAGGCAGGG - Intronic
1140106238 16:71962748-71962770 GGGATTGCAAACATGAGTCACGG + Intronic
1143827480 17:9622375-9622397 AGTTTTGTAAAGATGAGGAAGGG - Intronic
1143946374 17:10596280-10596302 GGCTTTGGAAGGCTGAGGCAGGG + Intergenic
1144300337 17:13917515-13917537 GAGGTTCAAATGATGAGGCAAGG + Intergenic
1144824360 17:18097568-18097590 GGGATTAAAAAGATAAGGCCCGG - Intronic
1144825455 17:18103285-18103307 GGGATTAAAAAGATAAGGCCCGG - Intronic
1145203479 17:20967690-20967712 GGGTGTGAAAACAGGAGGTAAGG + Intergenic
1145867028 17:28248020-28248042 GGGTTTGAAAAGGTGTGGTGGGG + Intergenic
1146194636 17:30801240-30801262 TGGCTGGTAAAGATGAGGCAGGG - Intronic
1146862345 17:36314362-36314384 TGATTTGAAAAGATAAGGCAGGG - Intronic
1147092673 17:38118461-38118483 TGATTTGAAAAGATAAGGCAGGG - Intergenic
1147104535 17:38202030-38202052 TGATTTGAAAAGATAAGGCAGGG + Intergenic
1148424958 17:47586418-47586440 TGATTTGAAAAGATAAGGCAGGG - Intronic
1149318867 17:55464515-55464537 GAGTTTGGAAAGATGGGCCAAGG + Intergenic
1149360685 17:55892335-55892357 GTGTTAGAAAAGCTGAGACAGGG + Intergenic
1151060102 17:71081660-71081682 GAGTTTGAAAAGATGTGAAATGG + Intergenic
1152088898 17:78236311-78236333 GGTTTGGCACAGATGAGGCAGGG + Intronic
1153460134 18:5324087-5324109 AGGTATGAAAAGATGAAGCCTGG + Intergenic
1153947093 18:10027640-10027662 GGGTTTGATATGAAGGGGCATGG + Intergenic
1155097238 18:22569525-22569547 GTGTGTGAAAAGATTTGGCAGGG - Intergenic
1156355589 18:36337718-36337740 GGATTTTAAAAGTTGTGGCAGGG + Intronic
1156840301 18:41603083-41603105 GGGCTTAAAAAGATGAGCCTGGG + Intergenic
1157699372 18:49751316-49751338 GGGTTCAAAGAGATGAGACATGG - Intergenic
1157930960 18:51822834-51822856 GGGTTGGCTAAGAAGAGGCAGGG - Intergenic
1157985065 18:52427891-52427913 GTGTTTCAAAAGATGTGCCAAGG - Intronic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1160294394 18:77623980-77624002 AGGGTTAAAAAGATGAGGCCAGG + Intergenic
1162313404 19:9921362-9921384 TGTTTTGAAAAGCTGAGGCAAGG - Intronic
1163042971 19:14616268-14616290 GGGTGTGAAGAAATGAGGCAGGG - Intergenic
1163572609 19:18091213-18091235 GGGCTTGCCAAGATGTGGCAAGG - Intronic
1165335994 19:35169909-35169931 GGGAGTGGAAAGAGGAGGCAGGG + Intergenic
1166592218 19:44009522-44009544 TGGCTGGAAAAGATGATGCAAGG - Intronic
1166798554 19:45442629-45442651 GGCTTTTCAAAGTTGAGGCAAGG + Intronic
926312655 2:11685872-11685894 GGGTTGGATAAGCAGAGGCACGG - Intronic
926321691 2:11752793-11752815 GGGTTAGGAAAGCTGTGGCAGGG + Intronic
926863762 2:17336872-17336894 TGTTGTGAAAAGATGAAGCAGGG + Intergenic
928624652 2:33127502-33127524 GGGTTGGAAATGAAGAGGCCTGG - Intronic
929011540 2:37450040-37450062 GTGTTTGAAAAAAAGAGGCAGGG + Intergenic
932347225 2:71003658-71003680 GGCTGTGAAAAGGTGAGACATGG - Intergenic
933427605 2:82132392-82132414 GGGTCTAAAAAGGGGAGGCATGG + Intergenic
933517716 2:83327136-83327158 GAGTTAGAGCAGATGAGGCATGG + Intergenic
934184931 2:89663240-89663262 GGATATGAAAATATAAGGCAAGG + Intergenic
934295201 2:91737363-91737385 GGATATGAAAATATAAGGCAAGG + Intergenic
934754985 2:96818549-96818571 GGGTTAGAAAAGAAGAGGTGAGG - Intronic
936999339 2:118450444-118450466 GGGTTAGAAATGATGAAGCAGGG - Intergenic
937088984 2:119192840-119192862 AGATTTTAAAAGAAGAGGCAGGG - Intergenic
937653870 2:124352153-124352175 GGATTTGATGAAATGAGGCAAGG - Intronic
937710352 2:124973883-124973905 GGGTTTGACAAGATATGGAAAGG - Intergenic
938411719 2:131070150-131070172 GGGTTTTAAAAGTTTAGGCTGGG - Intronic
938843024 2:135181259-135181281 GGGTTTGAAGGGATGAGTTAGGG + Intronic
940068290 2:149654292-149654314 GGATTTCAAAAGATAAGGAATGG - Intergenic
941592530 2:167437642-167437664 CTGTTTGAACAGATGAGCCAGGG - Intergenic
944763093 2:202837564-202837586 GGTTTTGAAAAGAGAAGGCCGGG - Intronic
947190406 2:227499367-227499389 GGGATTACAAACATGAGGCATGG - Intronic
947296936 2:228641527-228641549 GGGCTTGAAAAGCTGAGTTAAGG + Intergenic
947342694 2:229156720-229156742 GGGTTTGAGCAGAGGTGGCATGG - Intronic
947554186 2:231075174-231075196 GGGCTTGAAAAGAAGGGGCTGGG - Intronic
948413861 2:237786589-237786611 TGGTGGGAAAAGTTGAGGCAGGG + Intronic
1172017596 20:31887288-31887310 GGGATTGAAAAGGGGAGGGAGGG - Intronic
1172788993 20:37489470-37489492 AGGTTTGAAGAGATGAGAGAAGG + Intergenic
1173585923 20:44183103-44183125 TGGTTTGAAGAGAAGAGGGATGG + Intronic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1174177263 20:48652874-48652896 GGATGTGAAAATGTGAGGCAGGG + Intronic
1174258431 20:49276849-49276871 GGGTTTGATAAGATGAGGGAGGG - Intronic
1174291061 20:49508880-49508902 GGCATTGGTAAGATGAGGCAGGG - Intronic
1174958995 20:55134021-55134043 TGGTTTGAAAACATCAGGCTAGG - Intergenic
1176903612 21:14473756-14473778 GGGTATGATAATCTGAGGCAGGG - Intergenic
1177729052 21:25004889-25004911 GGGTTTTAACATATGAGTCAGGG - Intergenic
1178821807 21:35982317-35982339 GGGTATGAAAATATGTGTCATGG - Intronic
1179140577 21:38721525-38721547 GGGTCTGAAAAGCTGTGTCAGGG - Intergenic
1180137376 21:45870601-45870623 GGGTCTGAAGTGATGAGGCCTGG + Intronic
1180193552 21:46180896-46180918 GGGTTTGCCAAGATGACCCAAGG + Intronic
1180750496 22:18121199-18121221 GTGGTTGCAAAGATGAAGCAAGG - Intronic
1180816721 22:18794129-18794151 GGATATGAAAATATAAGGCAAGG - Intergenic
1181202912 22:21228476-21228498 GGATATGAAAATATAAGGCAAGG - Intergenic
1181382418 22:22516932-22516954 GGGTTTGAACATATGAGTTAAGG - Intronic
1181745732 22:24953658-24953680 GGGTGTGAAAAGGTCAGGCTCGG - Intronic
1181861054 22:25818485-25818507 GGTTTTGGTGAGATGAGGCATGG + Intronic
1184578622 22:45396356-45396378 GCATTTGAAAAGAGGAGGCATGG - Exonic
1203224007 22_KI270731v1_random:66950-66972 GGATATGAAAATATAAGGCAAGG + Intergenic
1203266820 22_KI270734v1_random:19850-19872 GGATATGAAAATATAAGGCAAGG - Intergenic
950737986 3:15026494-15026516 GGGTTTGAGAAGAGGGGGAAAGG - Intronic
951054968 3:18136920-18136942 GAGTTTGAAAAAAGGAGGGAGGG + Intronic
951442300 3:22737323-22737345 AGGTTTGAAAACATGATGGAAGG + Intergenic
951513272 3:23528414-23528436 CACTCTGAAAAGATGAGGCAGGG + Intronic
952186035 3:30969631-30969653 CTATTTGAAAAGATGAGGGAAGG - Intergenic
952996127 3:38884120-38884142 TGGTTTAAGAAGATGAGGAAAGG - Intronic
953639024 3:44688267-44688289 GGGTTTGCCAAGAAGAGTCATGG + Intergenic
954072826 3:48155507-48155529 AAGTTTGAAAACATGAGGCCTGG + Intergenic
956565282 3:70630082-70630104 GTGTTTGAAAAGATGAAACGAGG + Intergenic
956996508 3:74831944-74831966 GGATTTGAATAGAAGAGGCTTGG + Intergenic
957525858 3:81378206-81378228 GGGATTAAAAAGATGAGGACAGG + Intergenic
959604269 3:108224984-108225006 AGTTTTAAAAAGCTGAGGCAGGG - Intergenic
960741506 3:120838748-120838770 TGGTTTGAAAAGCTGATGTAAGG + Intergenic
961430912 3:126882271-126882293 AGGTTAGAGACGATGAGGCAAGG - Intronic
962235801 3:133706099-133706121 GGGTTTCAGAAGAGGAGGAATGG + Intergenic
963774335 3:149422949-149422971 AGGAGTGAAAAGATGAGGAAAGG + Intergenic
964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG + Intergenic
964644423 3:158943501-158943523 GGAGGTGAAAAGATCAGGCAGGG + Intergenic
965559244 3:170045875-170045897 AGGTTTTAAAAAATGAGTCAAGG - Intronic
965614091 3:170575356-170575378 CAGTTTGAAATGAGGAGGCAGGG + Intronic
966021398 3:175216231-175216253 ATATTTGACAAGATGAGGCAAGG - Intronic
966131671 3:176647963-176647985 GGGATTGAATAGGTGAAGCATGG + Intergenic
968882285 4:3307377-3307399 GGGTCTGAAGAGAGGAGGCCAGG + Intronic
969027553 4:4185875-4185897 CGGTTTGAAAAAATAAGGAATGG + Intergenic
970356440 4:15258360-15258382 TGGATGGAAAAGCTGAGGCATGG + Intergenic
971812190 4:31440406-31440428 ACGTTTGAGAAGATTAGGCAAGG - Intergenic
972643838 4:40949322-40949344 GTGGTTGAAAAGATCAGGAAAGG - Intronic
973743196 4:53938093-53938115 GCGGTGGAAAAGATGAGGCCAGG + Intronic
975628160 4:76370810-76370832 GGGTTTGATGAGCTGAGGTAAGG - Intronic
977719499 4:100223439-100223461 AGGTTTGGAATGAGGAGGCATGG - Intergenic
977737288 4:100432243-100432265 TGGTTTTAAAAGATGAGAAAGGG - Intronic
978232304 4:106414924-106414946 TGTTTAGAAAAGATGCGGCAGGG + Intergenic
981826343 4:148946244-148946266 GGTTTTGAAAAGCTAATGCAAGG + Intergenic
984698600 4:182803922-182803944 GCGCTTGAAAAGATGAGGAGAGG + Intergenic
984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG + Intronic
985166997 4:187107255-187107277 GGATTTGAACAGAGGAGGCAGGG - Intergenic
989502257 5:42181280-42181302 GGGTTGGAGGAGATGGGGCAGGG + Intergenic
990440417 5:55839329-55839351 GGCTTTCAGAGGATGAGGCATGG - Intergenic
992644912 5:78803026-78803048 CTGTTTGAAAACATGAGGAAGGG + Intronic
996105733 5:119500243-119500265 GGGTTAGAAAAGAGGAGTCAAGG + Intronic
996366276 5:122704326-122704348 GGTTCTGAATAGATGAGGAAAGG + Intergenic
997142378 5:131396453-131396475 GGCATTAAAAAGATGAGGTAGGG - Intronic
998992806 5:147837365-147837387 GGGTTTGAAATGATGAATTAGGG + Intergenic
999217204 5:149945205-149945227 GGGAGTGGAAGGATGAGGCAAGG - Intergenic
999894564 5:156016485-156016507 AGGTTGGAAAAGATAAGGGATGG - Intronic
1001635562 5:173207635-173207657 GGTTTTGAAAAGATCAGTCTGGG + Intergenic
1001794001 5:174486612-174486634 AGGATTGAATAGATGAAGCATGG + Intergenic
1002174390 5:177393333-177393355 GGGTAATAAAAGATGAGGAAGGG + Intronic
1002351479 5:178586471-178586493 GGCTTTGAAAATTTGAGGCATGG - Intronic
1002496619 5:179618159-179618181 GGCTTTGAGAGGATGAGGCGTGG - Exonic
1004366057 6:15013672-15013694 GAGTCTGAAAAGATGGGTCAGGG - Intergenic
1004545003 6:16589077-16589099 GAGTTTGAAAAGATGATGTGTGG - Intronic
1004751224 6:18564749-18564771 GGGTTTTAAAAGCTGTGGCTTGG + Intergenic
1005986453 6:30878783-30878805 AGATTTGCAGAGATGAGGCAAGG - Intronic
1006706272 6:36024126-36024148 GGGTCTGAAAGGAAGAGGAACGG + Intronic
1006713094 6:36092811-36092833 TGACTTGAAAAGATGAGCCATGG - Intronic
1006924118 6:37644770-37644792 GGGCTTCAAAAGACCAGGCATGG + Intronic
1008838007 6:55861250-55861272 GGGTCAGAGAAGCTGAGGCAAGG + Intronic
1011150731 6:84270386-84270408 AGGCATGAAAAGAGGAGGCAGGG + Intergenic
1011179149 6:84599851-84599873 GGCTTTTAAATTATGAGGCATGG + Intergenic
1011218510 6:85030580-85030602 GGGGTTGAGAAGATGAGGAGAGG - Intergenic
1011818001 6:91214823-91214845 GCGCATGAAAAGTTGAGGCAAGG + Intergenic
1011983101 6:93410122-93410144 GGGTTTAAAAACAGGAGGAATGG + Intronic
1012601704 6:101106329-101106351 GAGTTTTAAAAGATGAAGAAAGG + Intergenic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1015349333 6:132198366-132198388 GGGTATGTAAAGAACAGGCAGGG - Intergenic
1016380796 6:143476640-143476662 GGGTTATGAAAGAGGAGGCAAGG + Intronic
1017588562 6:155953632-155953654 GTGTGTGAAAACACGAGGCAAGG + Intergenic
1018016048 6:159713297-159713319 GGGTTTGAAAAGATGAGGCAGGG - Intronic
1020402967 7:7798638-7798660 GGGTGTGAAGAGAGGAGCCAAGG - Intronic
1020655017 7:10918499-10918521 GGATTTGAAACCATCAGGCAGGG - Intergenic
1020720158 7:11734060-11734082 GGGGTTGAAGAGATGACTCAAGG - Intronic
1022557696 7:31315969-31315991 GGGTTGGAACAGATGAGCAAAGG - Intergenic
1022600542 7:31754727-31754749 GCGTTTGGAAAGAGGAGGGATGG + Intronic
1023316461 7:38942857-38942879 GGGATGGAAAAGATGTGTCATGG + Intergenic
1023331783 7:39125794-39125816 AGGTTTGAAAAGGCAAGGCAAGG - Intronic
1023616620 7:42026273-42026295 GTGTTGGAAAAGTTGGGGCAGGG + Exonic
1023784611 7:43693545-43693567 GGAATTGAAAAGATAAGGGATGG - Intronic
1023963003 7:44943262-44943284 GGGTTTGGAAAGAAGAGGGGAGG + Intergenic
1024886748 7:54150969-54150991 GAGGTTGAAAAGATGAGGGATGG - Intergenic
1026009682 7:66627539-66627561 CGGTTTGAAAAGGAGAAGCATGG + Intergenic
1026117164 7:67505732-67505754 GATTTTGACAAGATGAGGAAAGG + Intergenic
1027198971 7:76050497-76050519 AGGTTTGAGAAAATGAGGCTAGG + Intronic
1027538830 7:79441983-79442005 GTGTTACAAAAGAAGAGGCAGGG - Intronic
1028021801 7:85785865-85785887 GTATTTGTATAGATGAGGCAGGG + Intergenic
1028895020 7:96031324-96031346 GGGTAAGAAAAGATTTGGCAGGG + Intronic
1030440271 7:109580373-109580395 GGTTTTGAAGTGAGGAGGCATGG + Intergenic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1031341823 7:120612243-120612265 GGGATTGGAAAGATGAGTTATGG - Intronic
1032347241 7:131127554-131127576 TGTGTTGAAAAGATCAGGCATGG + Intronic
1036728516 8:11241605-11241627 GGGTTTCAAAAGGGGAGGGAGGG - Intergenic
1036742664 8:11378961-11378983 GGGTTGGTAATGATGAGGCGGGG - Intergenic
1037011581 8:13850122-13850144 GGGTTTGAGGGAATGAGGCAAGG + Intergenic
1037266336 8:17065530-17065552 GGCTTTGAAAGGATGAGAAAAGG + Intronic
1037358729 8:18051173-18051195 GGATATGAAATAATGAGGCAGGG - Intergenic
1038902944 8:31864524-31864546 GGGTTTGAAGCCTTGAGGCAGGG + Intronic
1039458868 8:37727016-37727038 GGGTGTGGAAAGACGAGGCCTGG + Intergenic
1040565138 8:48558188-48558210 GGATTAGAAAAGGAGAGGCAGGG - Intergenic
1040629016 8:49187651-49187673 GTGTTTGAATAGGCGAGGCACGG + Intergenic
1043247996 8:78030224-78030246 GGGCTAGAAAAAATGAGGCTGGG - Intergenic
1043669749 8:82868046-82868068 GGGTTTGAAAAGATGAGGAGGGG + Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1046999205 8:120556626-120556648 GGTATTGCAAAGATGAGTCAAGG + Intronic
1047166404 8:122444199-122444221 GGGTAAGAGAAAATGAGGCAAGG + Intergenic
1047314780 8:123722858-123722880 GGGTGTGAAATGAGGAGGGAAGG - Intronic
1047673275 8:127172055-127172077 GGGTCTGGAAATGTGAGGCAGGG + Intergenic
1048549504 8:135421375-135421397 CGGTTTGAAAACTTGAGGCATGG + Intergenic
1048777834 8:137967214-137967236 GAATGTGCAAAGATGAGGCAAGG - Intergenic
1050959810 9:11714725-11714747 GGGTATGAAAAGATGTTTCAGGG - Intergenic
1051148198 9:14052391-14052413 GGTTTTAAAAAGATGTGGAAGGG + Intergenic
1051883891 9:21869653-21869675 GGTTTTGAAGAGAAGAGTCAAGG - Intronic
1052138880 9:24953150-24953172 GGGTTTGAAAATGTGAAGCTAGG - Intergenic
1052441676 9:28504899-28504921 TGGATTGAAATGATGATGCAGGG + Intronic
1054876539 9:70103003-70103025 TGGTTTTAAAAGATGAGAAAAGG + Intronic
1055567609 9:77584828-77584850 TGGTCTGAAAAGGGGAGGCATGG - Intronic
1056037353 9:82620669-82620691 AGGTCTGAAAAGATGAGGATTGG - Intergenic
1056886330 9:90447443-90447465 GGGTTTCTAGAGATGAGTCAAGG + Intergenic
1058037282 9:100266434-100266456 AGGTCTGAAAAGGGGAGGCATGG - Intronic
1059636524 9:116176830-116176852 GGAGTTGACAAGATGAGCCAAGG + Intronic
1059981285 9:119774786-119774808 GGGCTTCCAAAGATGAGTCATGG + Intergenic
1059983579 9:119799475-119799497 GGATTTGAAAATAGGAGGAAGGG - Intergenic
1060759963 9:126238725-126238747 TGGTTAGAAAAGATGATGCTCGG - Intergenic
1061387949 9:130301489-130301511 GGGTTTGGAGAGATGAGGGTGGG + Intronic
1062108532 9:134768799-134768821 GGGTTGGAAGCGAAGAGGCAGGG + Intronic
1185992236 X:4904139-4904161 AGGTGTGACAAGATGAGGCGAGG + Intergenic
1186195798 X:7109373-7109395 GGGTTTGAAAAGCCGAGTGAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187553125 X:20325890-20325912 GGCTTTGGAAATGTGAGGCAAGG - Intergenic
1187782921 X:22849045-22849067 GGGTATGCAGTGATGAGGCACGG + Intergenic
1188872494 X:35390095-35390117 GGGTGTAAAAAGATGAGTCTAGG + Intergenic
1189909958 X:45800707-45800729 CTGTTTTAAAAGATGGGGCAGGG + Intergenic
1192547960 X:72029047-72029069 GGGTGTGGAAAGCTTAGGCATGG + Intergenic
1194875645 X:99184655-99184677 AGGTTTGAAAAGTTGAGAAAAGG - Intergenic
1195085797 X:101412667-101412689 GGGTTTGAAAGGATGAGGCGTGG + Exonic
1195891948 X:109705113-109705135 TGGTTTTAAAAAATGAGGGATGG + Intronic
1196929989 X:120672316-120672338 GAGACTGAAGAGATGAGGCAAGG + Intergenic
1197236564 X:124072607-124072629 GGATATGAAAAGATGAGACAAGG + Intronic
1198618729 X:138483822-138483844 GTGTTTGAAAAGAGAAGTCAAGG + Intergenic
1198632834 X:138660744-138660766 AGGTTGGAAAGGGTGAGGCAGGG - Intronic
1198843019 X:140879621-140879643 GGGCTTGGAAAGATGTGGGATGG + Intergenic
1200249615 X:154545966-154545988 TAGTTGGAAAAGCTGAGGCATGG + Intronic