ID: 1018016897 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:159720762-159720784 |
| Sequence | AATTTAGTATCAGTAATAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018016897_1018016902 | 11 | Left | 1018016897 | 6:159720762-159720784 | CCCACTATTACTGATACTAAATT | No data | ||
| Right | 1018016902 | 6:159720796-159720818 | TTCAAATGGTGACCACCAGATGG | 0: 1 1: 0 2: 1 3: 12 4: 142 |
||||
| 1018016897_1018016904 | 25 | Left | 1018016897 | 6:159720762-159720784 | CCCACTATTACTGATACTAAATT | No data | ||
| Right | 1018016904 | 6:159720810-159720832 | ACCAGATGGCTCCACTATACAGG | 0: 1 1: 0 2: 0 3: 8 4: 64 |
||||
| 1018016897_1018016901 | -3 | Left | 1018016897 | 6:159720762-159720784 | CCCACTATTACTGATACTAAATT | No data | ||
| Right | 1018016901 | 6:159720782-159720804 | ATTTGATGGTTTGGTTCAAATGG | 0: 1 1: 0 2: 0 3: 18 4: 208 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018016897 | Original CRISPR | AATTTAGTATCAGTAATAGT GGG (reversed) | Intronic | ||