HTGT WGE

Individual CRISPR Summary

ID: 1018016898

 View in Genome Browser
Species Human (GRCh38)
Location 6:159720763-159720785
Sequence AAATTTAGTATCAGTAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018016898_1018016901 -4 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016901 6:159720782-159720804 ATTTGATGGTTTGGTTCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 208
1018016898_1018016904 24 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG 0: 1
1: 0
2: 0
3: 8
4: 64
1018016898_1018016902 10 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016902 6:159720796-159720818 TTCAAATGGTGACCACCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018016898 Original CRISPR AAATTTAGTATCAGTAATAG TGG (reversed) Intronic