ID: 1018016901 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:159720782-159720804 |
| Sequence | ATTTGATGGTTTGGTTCAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 227 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 18, 4: 208} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018016897_1018016901 | -3 | Left | 1018016897 | 6:159720762-159720784 | CCCACTATTACTGATACTAAATT | No data | ||
| Right | 1018016901 | 6:159720782-159720804 | ATTTGATGGTTTGGTTCAAATGG | 0: 1 1: 0 2: 0 3: 18 4: 208 |
||||
| 1018016898_1018016901 | -4 | Left | 1018016898 | 6:159720763-159720785 | CCACTATTACTGATACTAAATTT | 0: 1 1: 0 2: 0 3: 45 4: 299 |
||
| Right | 1018016901 | 6:159720782-159720804 | ATTTGATGGTTTGGTTCAAATGG | 0: 1 1: 0 2: 0 3: 18 4: 208 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018016901 | Original CRISPR | ATTTGATGGTTTGGTTCAAA TGG | Intronic | ||