ID: 1018016902

View in Genome Browser
Species Human (GRCh38)
Location 6:159720796-159720818
Sequence TTCAAATGGTGACCACCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018016898_1018016902 10 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016902 6:159720796-159720818 TTCAAATGGTGACCACCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 142
1018016897_1018016902 11 Left 1018016897 6:159720762-159720784 CCCACTATTACTGATACTAAATT No data
Right 1018016902 6:159720796-159720818 TTCAAATGGTGACCACCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018016902 Original CRISPR TTCAAATGGTGACCACCAGA TGG Intronic