ID: 1018016904

View in Genome Browser
Species Human (GRCh38)
Location 6:159720810-159720832
Sequence ACCAGATGGCTCCACTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018016898_1018016904 24 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG 0: 1
1: 0
2: 0
3: 8
4: 64
1018016897_1018016904 25 Left 1018016897 6:159720762-159720784 CCCACTATTACTGATACTAAATT No data
Right 1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018016904 Original CRISPR ACCAGATGGCTCCACTATAC AGG Intronic