ID: 1018016904

View in Genome Browser
Species Human (GRCh38)
Location 6:159720810-159720832
Sequence ACCAGATGGCTCCACTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018016897_1018016904 25 Left 1018016897 6:159720762-159720784 CCCACTATTACTGATACTAAATT 0: 1
1: 0
2: 3
3: 36
4: 267
Right 1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG 0: 1
1: 0
2: 0
3: 8
4: 64
1018016898_1018016904 24 Left 1018016898 6:159720763-159720785 CCACTATTACTGATACTAAATTT 0: 1
1: 0
2: 0
3: 45
4: 299
Right 1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018016904 Original CRISPR ACCAGATGGCTCCACTATAC AGG Intronic
902663311 1:17920431-17920453 ACCCTATGGCTCCACTGTGCTGG - Intergenic
904653038 1:32020562-32020584 ACCAAATGCCTCCAATAAACTGG + Intronic
907516104 1:54994430-54994452 ACCAGGAGGCACCACTTTACTGG + Intergenic
910428784 1:87140970-87140992 ATCAGATGACTCAACTGTACAGG + Intronic
917772952 1:178300096-178300118 ACCAGAGGGCGCCACTAAACTGG + Exonic
920837834 1:209528363-209528385 ACCAGCTGGCTCCTTTATAAAGG + Intergenic
923734205 1:236586802-236586824 ACTAGATGTCTCAACTCTACCGG + Intronic
924052252 1:240091532-240091554 ACCCGATGGCACCTCTAAACTGG + Intronic
1063123710 10:3122731-3122753 TGTAGATGGCTCCAGTATACTGG + Intronic
1074540554 10:114362017-114362039 TCCAGCTCTCTCCACTATACAGG - Intronic
1086140233 11:83490606-83490628 ACCAGATTTCTCCACTATAAAGG - Intronic
1087849024 11:103006955-103006977 ACCAGTTGGCTCCACTCTTATGG + Intergenic
1089144724 11:116317447-116317469 AGCAGATGGCTCCATTACAAAGG + Intergenic
1101269613 12:103129839-103129861 AACAGATGTCTCCACAATATGGG - Intergenic
1103133107 12:118485695-118485717 ACCAGATGGCTCCTATAGACTGG - Intergenic
1106211796 13:27655653-27655675 ACCAGATCTCTCCATTATAAAGG + Intronic
1106503226 13:30349023-30349045 ACCAGAGGGCTGCACCATTCGGG - Intergenic
1112671430 13:101643715-101643737 ACCAGCTGGATCCACTGTAGGGG + Intronic
1114396757 14:22370641-22370663 ACCACATGGATCCTCTACACTGG - Intergenic
1119571583 14:75678821-75678843 ACCAGATGGCTTCATTTTAAAGG + Intronic
1122906172 14:104802574-104802596 GCCAGATGGCTCCACCCTCCTGG + Exonic
1131642667 15:94309205-94309227 ATCAGACGGCTCCACTAACCAGG - Intronic
1132383323 15:101381846-101381868 AGCAGATTGCTCCACGATAGGGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1138175486 16:54894259-54894281 GCCCGATGGCTCCCCTATCCTGG + Intergenic
1138631652 16:58299943-58299965 ACCAGAGGGCGCCACTAACCAGG + Intronic
1150126893 17:62642426-62642448 ACCAGATCTCTCCACTAAAAAGG + Intronic
1150863575 17:68826018-68826040 GCCAGATTTCTCCACTATAAAGG + Intergenic
1165384321 19:35501680-35501702 AGCAGCTGCCTCCACTAGACAGG + Intronic
925483428 2:4302287-4302309 ACCAGATGGCTTCATTCTAATGG + Intergenic
928980390 2:37130466-37130488 ACCAGATGGCTCCTATAGACTGG + Intronic
929225425 2:39507252-39507274 AGCAGGTGGCTCCACTATGATGG + Intergenic
930375670 2:50563499-50563521 ACCAGATAACTCCTATATACTGG - Intronic
932135865 2:69228098-69228120 ACAAGCTGGGTCCACTATAGTGG - Intronic
940063089 2:149594685-149594707 AACAGATGGCTAGAATATACAGG - Intergenic
941066763 2:160911969-160911991 AGCAGATCGCTTCACTAAACAGG + Intergenic
941878918 2:170462020-170462042 ACCAGATGGGTCCACTCTGGAGG - Intronic
942340545 2:174940748-174940770 ACCAGATCTCTCCACTTTAAAGG + Intronic
1178981032 21:37265876-37265898 ACCAGATTTCTCCATTATAAAGG + Intronic
1181507846 22:23373685-23373707 ACCAGGTGGCTGCTCTATCCTGG - Intergenic
1182520859 22:30883824-30883846 ACCAGATGGCACCTCTTTGCTGG - Intronic
953367950 3:42362841-42362863 ACCAGATTTCTCCATTATAAAGG - Intergenic
958466607 3:94467582-94467604 ACCAGATCTCCCCACTATACAGG - Intergenic
973954381 4:56048931-56048953 ACCAGATGGCTCCCCTCCCCAGG - Intergenic
975101213 4:70515165-70515187 AACAGAAGCCTCCACTGTACTGG - Intergenic
976507387 4:85864058-85864080 ACAAGATGGCTCCAATCAACTGG - Intronic
978573458 4:110165239-110165261 AGCACATGGTTCCACTAAACAGG - Intronic
982063850 4:151633347-151633369 ACCAGATGGCTTCACTCTAGTGG + Intronic
996291169 5:121853574-121853596 ACTAGATGCCTCCTCTATTCTGG - Intergenic
996633472 5:125664612-125664634 ATCAGATGGCTCCTATAGACTGG - Intergenic
996718156 5:126604214-126604236 ACCAGATGGCTTCTATTTACAGG + Intronic
998496860 5:142598249-142598271 ACCTGATGTCTCTATTATACTGG + Intronic
998640651 5:144006757-144006779 TCCAGATGGCTTCACTCTTCTGG - Intergenic
998986137 5:147759597-147759619 ACCTGGTGGCTCCTCTAGACTGG + Intronic
1000673049 5:164086432-164086454 TCCAAATAGCTCCACTATAAAGG + Intergenic
1001726861 5:173910777-173910799 TCACGATGGCTCCACTATAGAGG - Intronic
1004502680 6:16222992-16223014 ACCAGAAGTCTCCACTGTCCTGG - Intergenic
1006316272 6:33293666-33293688 ACCAGGTGGCTCCACCTCACAGG + Exonic
1018016904 6:159720810-159720832 ACCAGATGGCTCCACTATACAGG + Intronic
1018605586 6:165594748-165594770 GCCAGATGTCTCCACCATAAAGG - Intronic
1029048260 7:97654853-97654875 ACAAGATGGCACCACCATGCAGG - Intergenic
1031519132 7:122741937-122741959 ACCAGTTCGCTCCAATATCCTGG + Intronic
1032438455 7:131921728-131921750 ACCAGATGGCTCCCGTAAAAGGG + Intergenic
1036446629 8:8826839-8826861 GCAAGATGGCTGCACTGTACCGG - Intronic
1047544969 8:125806975-125806997 CCCAGCTGGCTCCACTATTTTGG + Intergenic
1047743630 8:127827448-127827470 GGCTGATGGCTCCCCTATACAGG - Intergenic
1051732184 9:20156028-20156050 TCCAGATGGATACACTACACAGG - Intergenic
1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG + Intronic
1058876694 9:109250734-109250756 ACCAGATCATTCTACTATACAGG + Intronic
1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG + Intergenic
1190072477 X:47290717-47290739 ACCAGATGGCTCCTATAGACTGG - Intergenic
1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG + Intronic
1201950671 Y:19559868-19559890 ACCAAATGGCCCAACTAGACAGG - Intergenic