ID: 1018016904 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:159720810-159720832 |
Sequence | ACCAGATGGCTCCACTATAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 73 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 64} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1018016898_1018016904 | 24 | Left | 1018016898 | 6:159720763-159720785 | CCACTATTACTGATACTAAATTT | 0: 1 1: 0 2: 0 3: 45 4: 299 |
||
Right | 1018016904 | 6:159720810-159720832 | ACCAGATGGCTCCACTATACAGG | 0: 1 1: 0 2: 0 3: 8 4: 64 |
||||
1018016897_1018016904 | 25 | Left | 1018016897 | 6:159720762-159720784 | CCCACTATTACTGATACTAAATT | No data | ||
Right | 1018016904 | 6:159720810-159720832 | ACCAGATGGCTCCACTATACAGG | 0: 1 1: 0 2: 0 3: 8 4: 64 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1018016904 | Original CRISPR | ACCAGATGGCTCCACTATAC AGG | Intronic | ||