ID: 1018017132

View in Genome Browser
Species Human (GRCh38)
Location 6:159722669-159722691
Sequence CTGAAAATACAAATGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1297
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 1217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018017128_1018017132 21 Left 1018017128 6:159722625-159722647 CCTTCAAGCTGGCTCCCATGTCT 0: 1
1: 0
2: 12
3: 92
4: 524
Right 1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG 0: 1
1: 0
2: 4
3: 75
4: 1217
1018017129_1018017132 7 Left 1018017129 6:159722639-159722661 CCCATGTCTCTAAAATTTATTTT 0: 1
1: 0
2: 7
3: 143
4: 1233
Right 1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG 0: 1
1: 0
2: 4
3: 75
4: 1217
1018017130_1018017132 6 Left 1018017130 6:159722640-159722662 CCATGTCTCTAAAATTTATTTTT 0: 1
1: 12
2: 146
3: 760
4: 3752
Right 1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG 0: 1
1: 0
2: 4
3: 75
4: 1217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018017132 Original CRISPR CTGAAAATACAAATGGTAAA TGG Intronic
900080452 1:853122-853144 CTGAAAATACAAAAATTAGACGG - Intergenic
900085545 1:893613-893635 CTGAAAATACAAAAATTAACTGG + Intergenic
900279427 1:1856587-1856609 CTGAAAATACAAAAGTTAGCTGG - Intronic
900286615 1:1904109-1904131 CTGAAAATACAAATATTAGCCGG + Intergenic
900383216 1:2395649-2395671 GTAAAAACACAAATGGTATATGG + Intronic
901671583 1:10859241-10859263 CTAAAAATACAAAAGCTAACTGG + Intergenic
901803574 1:11723752-11723774 CTAAAAATACAAACAGTAACCGG - Exonic
902007508 1:13244010-13244032 CTGAAAATACAAAAATTAACTGG + Intergenic
902296656 1:15472262-15472284 CTAAAAATACAAAAATTAAATGG + Intronic
902390457 1:16101308-16101330 CTGAAAATACAAAAGTTAGCTGG + Intergenic
902461213 1:16578507-16578529 CTAAAAATACAAAAAGTAGATGG - Intronic
902461995 1:16584803-16584825 CTAAAAATACAAAAAGTAGATGG - Intronic
902462769 1:16591161-16591183 CTAAAAATACAAAAAGTAGATGG - Intronic
902638579 1:17751277-17751299 TTGGAAATAGAACTGGTAAAGGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902849189 1:19140405-19140427 ATGAAGATAAAAAAGGTAAAAGG + Intronic
903073404 1:20741414-20741436 ATGAAAAAACAAATGTCAAAAGG + Intergenic
903233347 1:21935066-21935088 CTGAAAATACAAAAATTAGACGG - Intronic
903635629 1:24813203-24813225 CTAAAAATACAAAAGTTAATTGG - Intronic
903904719 1:26676514-26676536 TTAAAAATACAAATGTTAACTGG - Intergenic
903910535 1:26721371-26721393 CTGAAAATACAAATATTAGCCGG - Intronic
904078170 1:27855411-27855433 CTAAAAATACAAAAACTAAAGGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904501829 1:30917205-30917227 CTGAAAATACAAAAAGTAGCCGG + Intergenic
904595687 1:31643908-31643930 CTAAAAATCAAAATGCTAAAGGG + Intronic
904665971 1:32121809-32121831 CTAAAAATACAAAAGTTAACCGG + Intronic
904793248 1:33039543-33039565 CTGAAAATACAAAAGTTAGCCGG - Intronic
905063021 1:35155756-35155778 CTGAAAATACAAAAAGTAGCCGG - Intergenic
905540892 1:38759679-38759701 CTAAAGATACAAATGGTAATGGG + Intergenic
905564979 1:38956937-38956959 CTAAAAATACAAAAGTTAGATGG - Intergenic
905628139 1:39502074-39502096 CTGAAAATACAAAAGTTAGCTGG + Intronic
905639636 1:39580022-39580044 CTGAAAATACAAAAAGTAGCTGG - Intergenic
905748663 1:40441797-40441819 CTGAAAATACAAAAGTTAGCCGG - Intergenic
906121690 1:43397263-43397285 CTGAAAATACAAAAATTAACTGG + Intronic
906130318 1:43451790-43451812 CTCCAATTACAAATGGTAAGTGG - Exonic
906134186 1:43484018-43484040 CTGAAAATACAAATATTAGCTGG - Intergenic
906413506 1:45599587-45599609 CTGAAAATACAAAAGTTAGCCGG - Intronic
906625650 1:47323124-47323146 CTGAAAATACAAAAATTAACTGG - Intergenic
906974026 1:50549611-50549633 CTGAAAATACAAAAAGTAGCTGG + Intronic
907186625 1:52614585-52614607 CTAAAAATACAAATATTAACCGG + Intergenic
907852807 1:58272762-58272784 CAAAAGAGACAAATGGTAAAGGG - Intronic
908962602 1:69716947-69716969 CAGAAAATACTAAAGCTAAAAGG + Intronic
909262533 1:73510952-73510974 CTGAAAACATAATTGTTAAAAGG + Intergenic
909289659 1:73866402-73866424 CTGAAAATACAAAAATTCAATGG + Intergenic
909610710 1:77549035-77549057 CTAAAAATACAAAAAGTAGACGG - Intronic
909912050 1:81272673-81272695 CTGAAACCACAATTGCTAAATGG + Intergenic
910009457 1:82443170-82443192 CTGAAAGTACAGATATTAAATGG + Intergenic
910136913 1:83983168-83983190 CTAAAAATACAAAACGTAACTGG + Intronic
910386691 1:86691244-86691266 ATGAAAATATAAAAGGGAAAAGG + Intergenic
910738272 1:90486527-90486549 CTGAAAATAAAAAAACTAAATGG + Intergenic
911096338 1:94058128-94058150 CAGATAAAACAAATGGCAAAGGG + Intronic
911444793 1:97978331-97978353 CTAAAAATACAAAAGTTAACTGG - Intergenic
911555953 1:99344658-99344680 CAGAAAATACAAGTTTTAAAAGG - Intergenic
911857762 1:102903026-102903048 CTGAAAATGCACATATTAAATGG - Intronic
912087138 1:106022197-106022219 ATCAAAATTCAAATGGAAAAAGG + Intergenic
913488211 1:119353461-119353483 CTGAAAATACAAAAAGTAGCTGG - Intergenic
913587548 1:120290461-120290483 ATGAAAATACAAAAAATAAAAGG - Intergenic
913602707 1:120437361-120437383 CTAAAAATACAAAAAGTAGATGG + Intergenic
913603455 1:120443714-120443736 CTAAAAATACAAAAAGTAGATGG + Intergenic
913604205 1:120450063-120450085 CTAAAAATACAAAAAGTAGATGG + Intergenic
913620637 1:120607908-120607930 ATGAAAATACAAAAAATAAAAGG + Intergenic
913640309 1:120806429-120806451 CTAAAAATACAAAAAGTAGATGG + Intronic
913641080 1:120812759-120812781 CTAAAAATACAAAAAGTAGATGG + Intronic
914084333 1:144439143-144439165 CTAAAAATACAAAAAGTAGATGG - Intronic
914190347 1:145404418-145404440 CTAAAAATACAAAAAGTAGATGG - Intronic
914212204 1:145590200-145590222 CTAAAAATACAAAAAGTAGATGG - Intergenic
914262748 1:146012552-146012574 CTAAAAATACAAAAAGTAGACGG + Intergenic
914277403 1:146137550-146137572 CTAAAAATACAAAAAGTAGATGG - Intronic
914278168 1:146143909-146143931 CTAAAAATACAAAAAGTAGATGG - Intronic
914363879 1:146960982-146961004 CTAAAAATACAAAAAGTAGATGG + Intronic
914364638 1:146967337-146967359 CTAAAAATACAAAAAGTAGATGG + Intronic
914365403 1:146973624-146973646 CTAAAAATACAAAAAGTAGATGG + Intronic
914487043 1:148119815-148119837 CTAAAAATACAAAAAGTAGATGG - Intronic
914487795 1:148126160-148126182 CTAAAAATACAAAAAGTAGATGG - Intronic
914538451 1:148588498-148588520 CTAAAAATACAAAAAGTAGATGG - Intronic
914569566 1:148902345-148902367 ATGAAAATACAAAAAATAAAAGG - Intronic
914587379 1:149074971-149074993 CTAAAAATACAAAAAGTAGATGG - Intronic
914588151 1:149081279-149081301 CTAAAAATACAAAAAGTAGATGG - Intronic
914603262 1:149227911-149227933 ATGAAAATACAAAAAATAAAAGG + Intergenic
914627464 1:149476771-149476793 CTAAAAATACAAAAAGTAGATGG + Intergenic
915377111 1:155406040-155406062 CTAAAAATACAAAAAGTAGATGG + Intronic
915573154 1:156756952-156756974 CTAAAAATACAAAAATTAAATGG - Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
916405926 1:164497907-164497929 CTGAAAATGCAAATGTCATAGGG - Intergenic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917331023 1:173880397-173880419 CTGAAAATTAGAATGGTAGAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917692573 1:177484282-177484304 CTGAAAATACAAAAATTAGATGG + Intergenic
917879456 1:179319775-179319797 CTGAAAATACAAAAGTTAGCTGG - Intronic
917999708 1:180480867-180480889 CTGAAAATACAAAAATTAACTGG + Intronic
918539384 1:185612350-185612372 ACAAACATACAAATGGTAAACGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918689015 1:187457099-187457121 ATGAATATACATATGGTACAAGG - Intergenic
918816022 1:189184491-189184513 CAGCAAAAGCAAATGGTAAAAGG - Intergenic
918834068 1:189436887-189436909 CTGAAAATAAAAATAAAAAATGG - Intergenic
918902528 1:190443072-190443094 CTAAAAATACAAAATGTAGACGG - Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919256718 1:195135321-195135343 CTGAAAATACAAAAATTAACAGG - Intergenic
919364450 1:196639407-196639429 CTGAAAATACAAAAGTTAGCAGG + Intergenic
919528216 1:198680289-198680311 CTGAAAATACAAATATTAGCCGG + Intronic
919698550 1:200607298-200607320 CTGAAAATACAAAAGTTAGCTGG - Intronic
919701260 1:200633293-200633315 CTGAAAATACAAAAGATAGCTGG + Intronic
919828141 1:201518650-201518672 CTGAAAAAACAACTGATGAAAGG + Intergenic
920133848 1:203753768-203753790 CTGAAAATACAAAAGTTAGCCGG + Intergenic
920153692 1:203930986-203931008 CTGAAAATACAAAAGTTAGCCGG + Intergenic
920206134 1:204293294-204293316 CTGAAAATACAAAAATTAACTGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920233604 1:204486967-204486989 CTGAAAATACAAAGATTAACTGG - Intronic
920710225 1:208287803-208287825 CTGAAAACACAAAAAGTATATGG - Intergenic
920944815 1:210518629-210518651 CTGAAAATACAAATATTAGCCGG + Intronic
921371820 1:214431474-214431496 CTGAACATACAAAGAGTGAATGG + Intronic
921661115 1:217803854-217803876 CTAAAAATACAAAAGGTAGCCGG + Intronic
921661690 1:217810458-217810480 CTAAAAATACAAAAATTAAATGG + Intronic
921855764 1:219982230-219982252 CTGAAATTACGTATGGTAAATGG - Intronic
922121977 1:222680243-222680265 CTGAAAAAAAAAATACTAAATGG - Intronic
922298484 1:224273249-224273271 CTGAAAATACAAATATTAGCTGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922625985 1:227043463-227043485 CTCAAAATAGAAATTTTAAAAGG - Intronic
923819455 1:237421075-237421097 CTGAAAATACAAAAGTTAGCCGG + Intronic
923989208 1:239415973-239415995 CTGAATATACACATGGTAGCAGG + Intronic
924103347 1:240626403-240626425 TTGAAAATCCAAAGGCTAAAAGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924534806 1:244926485-244926507 CTAAAAATACAAAAGGTAGCTGG - Intergenic
924538978 1:244963118-244963140 CTGAAAATACAAATATTATCTGG + Intergenic
924646559 1:245883103-245883125 CAGAAAAGACAAATGTGAAAAGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062867422 10:867697-867719 CTGAAAATACAAAAGTTAGCTGG + Intronic
1063314668 10:4990876-4990898 CAGAAAATACAAAATGAAAATGG - Intronic
1063471191 10:6287249-6287271 CTAAAAATACAAAAGTTAGATGG - Intergenic
1064133677 10:12732077-12732099 CTAAAAATACAAAAAGTAACTGG + Intronic
1064152099 10:12873770-12873792 CTGAAAATACAAAAATTAACTGG + Intergenic
1064377482 10:14810073-14810095 CTGAAAATACAAAAGTTCACCGG + Intergenic
1064730342 10:18324692-18324714 CTGAAAATACAAAAATTAACTGG + Intronic
1064787260 10:18911762-18911784 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1065632746 10:27697724-27697746 CTCAAAATACAAATTGCAAATGG + Intronic
1065686531 10:28290632-28290654 CTAAAAATACAAAAGTTAACTGG - Intronic
1065769773 10:29067060-29067082 CTTTAAAGACAAATGGCAAATGG + Intergenic
1065846043 10:29744439-29744461 CTGAAAATACAAATATTAGCTGG - Intergenic
1066046479 10:31599868-31599890 CAGAGAACACACATGGTAAAGGG + Intergenic
1066314088 10:34226386-34226408 CTGAAAATACAAAAAGTAGCTGG + Intronic
1066382617 10:34913979-34914001 CTAAAAATACAAAAAGTAACTGG + Intergenic
1066471083 10:35698921-35698943 CTAAAAATACAAAAGGTAGGAGG - Intergenic
1066702178 10:38141946-38141968 CTAAAAATACAAAAAGTAACCGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067690844 10:48501073-48501095 GTGAAAAGACAAATGGCAAAAGG + Intronic
1068380153 10:56242745-56242767 CTAAAAATACAAAAGGTACCCGG - Intergenic
1068502783 10:57861343-57861365 CGGAAAAGTCAAATTGTAAAAGG + Intergenic
1069000764 10:63261417-63261439 CTGAAAATACAAATATTAGCTGG + Intronic
1069037054 10:63656427-63656449 CTAAAAATACAAAAATTAAATGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069515892 10:69076992-69077014 CTGAAAATACAAAAATTAGATGG - Intergenic
1069524715 10:69159217-69159239 CTGAAAATACAAAAATTAGATGG + Intronic
1069966488 10:72122255-72122277 CTGAAAATACAAAAAGTAGCTGG + Intronic
1070046770 10:72846202-72846224 CTGAAAATACAAATATTAGCTGG - Intronic
1070389056 10:75952914-75952936 CTAAAAATACAAAAGGTAGCTGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071032657 10:81203826-81203848 CTGAAAATACAAATATTAGCTGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1072078447 10:92002993-92003015 CTGAAAATACAAAAGTTAGCTGG + Intronic
1072141460 10:92592474-92592496 CTGAAAATACAAATATTAGCCGG + Intergenic
1072482430 10:95822159-95822181 CTGAAAATACAAAAATTAGATGG - Intronic
1072627904 10:97125675-97125697 CTGAAAATACAAAAATTAGATGG + Intronic
1073172980 10:101528295-101528317 GTGAAAATGCCAAAGGTAAAAGG + Intronic
1073411878 10:103349640-103349662 CTGAAAATACAAAAAGTAGCGGG - Intronic
1073412262 10:103351790-103351812 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1073789155 10:106922057-106922079 CTGAAAATGCCACTTGTAAATGG + Intronic
1074530241 10:114292113-114292135 CTAAAAATACAAAAGGTAGCCGG + Intergenic
1074726671 10:116317248-116317270 TTGAAAAAGGAAATGGTAAAGGG + Intergenic
1074896150 10:117779234-117779256 CTCAAAACACAAATAGTAGAAGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075006348 10:118833099-118833121 CTGAAAATACAAAAATTAACTGG - Intergenic
1075394826 10:122119750-122119772 CTGAAAATATAAATGTTAGCTGG + Intronic
1075501492 10:122979297-122979319 CTGAAAATACAAAAATTAATTGG + Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075782301 10:125025275-125025297 GTTAAAATAAAAATTGTAAATGG + Intronic
1076049717 10:127322717-127322739 CTGACAATACAAAAAGTGAATGG - Intronic
1076155090 10:128198244-128198266 CTAAAAATACAAATATTAATTGG - Intergenic
1077136054 11:999348-999370 CTGAAAATACAAAAATTAACTGG + Intronic
1077949920 11:6945274-6945296 GTGAAAATACAAGTGAGAAAAGG - Intronic
1078254029 11:9641974-9641996 CTGAAAATACAAAAATTAACCGG - Intergenic
1078662843 11:13301096-13301118 CTGAAAATACAAAAATTAACTGG - Intronic
1078786844 11:14502877-14502899 CTAAAAATACAAAAATTAAATGG - Intergenic
1078838465 11:15054932-15054954 CTAAAAATACAAAAGGTAGCTGG - Intronic
1078889692 11:15543344-15543366 ATGAAAACACAACTGGTTAAGGG - Intergenic
1079264602 11:18918683-18918705 CTGAAAATACAAAAAGTAGTTGG + Intergenic
1079623564 11:22585931-22585953 ATAAATATTCAAATGGTAAATGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1079948222 11:26769499-26769521 CTGAAAAATCAAATCATAAAAGG - Intergenic
1080113522 11:28596499-28596521 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1080401790 11:31943042-31943064 CAGAAAATATAAATGGTAGTGGG + Intronic
1081150857 11:39629506-39629528 CTGAAAATACAACTTTTAAATGG - Intergenic
1081158650 11:39726834-39726856 CTAATAATACAGGTGGTAAATGG - Intergenic
1081571999 11:44297554-44297576 CTAAAAATACAAAAGTTAACTGG + Intronic
1081748835 11:45493183-45493205 CTGAAAATTCATATTGCAAAGGG + Intergenic
1081956823 11:47099960-47099982 GTGAAAATACAAATTGGAATAGG - Intronic
1082727628 11:56755496-56755518 CAGAGAATATAAATAGTAAAGGG - Intergenic
1082771948 11:57214584-57214606 CTGAAAATACTACTGGTACTTGG - Intergenic
1083031728 11:59598749-59598771 CTAAAAATACAAAAGTTAAACGG - Intronic
1083118483 11:60488399-60488421 CTAAAAATACAAAAAGTAACTGG + Intergenic
1083192929 11:61065522-61065544 CTGAAAATACAAAAAGTAGCTGG + Intergenic
1083387150 11:62319781-62319803 CTAAAAATACAAAAGTTAACTGG - Intergenic
1083403611 11:62441661-62441683 CTGAAAATACAAAAGTTAGCTGG - Intronic
1083434213 11:62631622-62631644 CTGAAAATACAAAAGTTAGCTGG - Intronic
1083739246 11:64699572-64699594 CTGAAAATACAAAAAGTAGCCGG - Intronic
1084136347 11:67185465-67185487 CTGAAAATACAAAACTTAACTGG + Intronic
1084480706 11:69418442-69418464 CTGAAAATACAAAAATTAACTGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087502701 11:98978721-98978743 CTAAAAATACAAAAATTAAATGG - Intergenic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1088034125 11:105291105-105291127 CTCAAAATAAATATGCTAAATGG + Intergenic
1088153557 11:106777283-106777305 CTGAAAATACAAAAATTAACTGG + Intronic
1088260787 11:107941935-107941957 CTGAAAATACAAAAAGTAGCTGG + Intronic
1088590419 11:111398253-111398275 CTGAAACTACACTTGGTCAATGG - Intronic
1089068685 11:115681790-115681812 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1089091039 11:115876266-115876288 ATAAAAATAAAAATTGTAAAGGG - Intergenic
1090422531 11:126585393-126585415 CTGAAAATACAAAATGTAGCCGG - Intronic
1090861816 11:130660739-130660761 CTAAAAATACAAAAAGTAGATGG - Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1092400447 12:8171896-8171918 CTGAAAATACAAAAATTAACTGG - Intronic
1092665828 12:10796377-10796399 ACAAAAATAAAAATGGTAAATGG + Intergenic
1092779780 12:11974861-11974883 CCAAAAATACAAATGAGAAAAGG + Intergenic
1093164904 12:15792834-15792856 CTGAAAATACAAATATTAGCAGG + Intronic
1093409463 12:18846732-18846754 CTGTAAATAAAAATATTAAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093623538 12:21320658-21320680 CTAAAAATACAAAAGCTAACCGG - Intronic
1093655061 12:21684997-21685019 CTGAAAATACAAAAATTAACCGG - Intronic
1093876157 12:24351879-24351901 CTGAAAATAACCATGGTAACAGG - Intergenic
1093957650 12:25239789-25239811 CTAAAAATACAAAAAGTAATTGG + Intronic
1094085859 12:26590916-26590938 CTAAAAATACAAAAATTAAACGG + Intronic
1094104521 12:26796576-26796598 CTAGAAATAGAAATGGTGAATGG - Intronic
1094295927 12:28904796-28904818 CTGAAAATAAAAATATTTAAAGG - Intergenic
1094649201 12:32358573-32358595 CTAAAAATACAAAAGTTAACTGG + Intronic
1094657285 12:32432452-32432474 CTGAAAATACAAAAGTTAGCTGG + Intronic
1095268701 12:40190870-40190892 CTCAAAAAACACAAGGTAAAAGG - Intergenic
1095437864 12:42211263-42211285 CTGAAAATACAAAAATTAGATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096393777 12:51249776-51249798 CTGAAAATACAAAAATTAACTGG - Intronic
1097090658 12:56501870-56501892 CTAAAAATACAAAAGTTAACCGG - Intergenic
1097116669 12:56702469-56702491 CTAAAAATACAAATGTTAGCGGG + Intergenic
1098038806 12:66333996-66334018 CTAAAAATACAAAAGTTAACTGG + Intronic
1098045159 12:66392817-66392839 CTGAAAAGCCAAATAGTAATAGG + Intronic
1098125668 12:67290347-67290369 CTAAAAATACAAAAAGTAATGGG + Intronic
1098394237 12:70001698-70001720 CTGAAAAACAAAATGGTGAAGGG - Intergenic
1098865470 12:75757894-75757916 CTCAAAAGATAAATGGGAAATGG + Intergenic
1099026622 12:77472226-77472248 CTGAGAATAAATATGGCAAATGG + Intergenic
1099079293 12:78156235-78156257 CTGAAAAAACAATTAATAAATGG - Intronic
1099137997 12:78932474-78932496 ATGAAAATACAAATTTTGAAAGG + Intronic
1099170572 12:79359225-79359247 CTGGAAACCCATATGGTAAAGGG + Intronic
1099182829 12:79487164-79487186 CTGAAAATACAAAAATTAACCGG - Intergenic
1099454698 12:82849652-82849674 CTGAAACTACCAATGTTACATGG + Intronic
1099572276 12:84338043-84338065 CTAAAAATACAAAAGTTAACTGG - Intergenic
1099663777 12:85599555-85599577 CTGAAAATACAAAAATTAGATGG + Intergenic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1099947998 12:89266788-89266810 CTAAAAATACAAAAAGTAACCGG - Intergenic
1100229000 12:92588327-92588349 CTAAAAATACAAAAAGTAACTGG + Intergenic
1101055669 12:100910538-100910560 CCAAAAATATAAGTGGTAAATGG + Intronic
1101119679 12:101565823-101565845 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1101509319 12:105378896-105378918 CTAAAAAGACAATTTGTAAAAGG + Intronic
1101652044 12:106686247-106686269 CTAAAAATACAAATGTTAGCTGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101893622 12:108737498-108737520 CTAAAAATACAAAAATTAAATGG - Intergenic
1102048740 12:109846946-109846968 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1102099723 12:110269196-110269218 CTGAAAATACAAAAATTAACTGG - Intergenic
1102173230 12:110857942-110857964 CTAAAAATACAAAAAGTAACTGG + Intronic
1102374409 12:112409847-112409869 CTAAAAATACAAAAGGTAGCCGG + Intronic
1102448780 12:113024902-113024924 CTGAAAATACAAAAATTAACCGG - Intergenic
1102464911 12:113123743-113123765 CTGAAAATACAAAAATTAGATGG - Intronic
1102671814 12:114625881-114625903 CTGAAAATACAAATATTAGCTGG + Intergenic
1102853059 12:116269218-116269240 CTGAAAATACAAAAAGTAGCTGG - Intronic
1102870777 12:116412384-116412406 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1103234027 12:119357222-119357244 CTCAAAACAGAAATGATAAATGG - Intronic
1103288144 12:119820387-119820409 CTGAAAATACAAAAAGTAGCCGG + Intronic
1103302487 12:119938615-119938637 CTAAAAATACAAAAGTTAGATGG + Intergenic
1103372505 12:120430208-120430230 CTAAAAATACAAAAATTAAACGG - Intergenic
1103503906 12:121427378-121427400 CTAAAAATACAAAAGTTAACTGG + Intronic
1103729299 12:123016162-123016184 CTGAAAATACAAAAAGTAGCTGG + Intronic
1103766909 12:123286858-123286880 CAGAAGATACAAATGTTAACTGG - Intergenic
1104068229 12:125323272-125323294 CTGAAAATACAAATATTAGCCGG + Intronic
1104071051 12:125345606-125345628 CTCAAAATACCAATGGCAGATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104116293 12:125752130-125752152 CTGAAAAATTGAATGGTAAAAGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104510116 12:129369770-129369792 CTGAAGCTACAAATAGGAAAAGG + Intronic
1105658427 13:22465897-22465919 CTGAAAATATACAAGGTAATCGG + Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106396939 13:29390490-29390512 CTGAAAATACAAAAATTAACAGG + Intronic
1106432200 13:29691888-29691910 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1106528360 13:30563940-30563962 ATAAAAATTAAAATGGTAAATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107026639 13:35808620-35808642 CTAAAAATACAAAAAGTAACTGG + Intronic
1107077324 13:36337152-36337174 CTGAAAATATTAATATTAAATGG + Intronic
1107218546 13:37951806-37951828 CTGAAACAAAAAATGGGAAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107829433 13:44361382-44361404 CTAAAAATACAAAAGGTTAGCGG - Intergenic
1108156356 13:47589323-47589345 GTGAAAACACAAGTTGTAAAGGG + Intergenic
1108242778 13:48484137-48484159 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108535462 13:51371977-51371999 TTGAAAATAAAAATGAGAAAAGG - Intronic
1108702076 13:52952316-52952338 CTGAAAATACAAATATTAACTGG + Intergenic
1108792707 13:53991656-53991678 ATAAAAATAAAAATGGTGAAAGG + Intergenic
1108933461 13:55860585-55860607 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1108992239 13:56674482-56674504 CTAAAAATACAAAAATTAAATGG - Intergenic
1109148669 13:58815869-58815891 CTGAAAATACAAAAGTTGTAGGG - Intergenic
1109436999 13:62316499-62316521 CTGAAAATACAAAAATTAACTGG + Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109549372 13:63873181-63873203 TTGATAATACAAAAGGAAAATGG - Intergenic
1109670754 13:65603809-65603831 CTGAAAATACAAAAGTTAGCCGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109737024 13:66499131-66499153 CTGAAAATACATAGGGTATAAGG - Intronic
1109832432 13:67808961-67808983 CTAAAACTACAAAGGGCAAATGG + Intergenic
1109853558 13:68100753-68100775 ATGAACACACAAATGATAAAGGG - Intergenic
1110070268 13:71166674-71166696 CTGAAAAGAAAAATTTTAAAAGG + Intergenic
1110072651 13:71196365-71196387 AATAAAATACAATTGGTAAAAGG - Intergenic
1110187020 13:72686838-72686860 CTGAAAATACACAGGCGAAATGG + Intergenic
1110325846 13:74214793-74214815 CTCAAAAAAAAAATGGTTAAAGG - Intergenic
1110427005 13:75380038-75380060 CTAAAAATACAAAGGTTAACTGG - Intronic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110912336 13:80980557-80980579 CTAAAAATACAAAAATTAAATGG + Intergenic
1111184030 13:84705792-84705814 CTGAAAATACAAATATTAGCTGG + Intergenic
1111312944 13:86513701-86513723 CTAAAAATACAAAAATTAAATGG - Intergenic
1111397978 13:87692649-87692671 CTAAAAATACAAATATTAATTGG + Exonic
1111480661 13:88821339-88821361 AGGAAAATAAAGATGGTAAAAGG + Intergenic
1111587881 13:90306380-90306402 CTGAAAATACAAAAATTAGATGG - Intergenic
1111597761 13:90433166-90433188 TTGAAAAAACAAATGGGAGAGGG - Intergenic
1111699363 13:91666462-91666484 CTCAAAAGACAAATGCTAAAAGG - Intronic
1111800839 13:92978548-92978570 CTGAAAATACAAATATTAGCTGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112270909 13:97968848-97968870 CTAAAAATACAAATGTTAGCTGG - Intronic
1112302955 13:98247063-98247085 CTAAAAATACAAAAGTTAACTGG + Intronic
1112890898 13:104230080-104230102 CTGAAATTCCCAATGTTAAAAGG + Intergenic
1112893849 13:104273365-104273387 TTCAAAAGACAAATAGTAAAAGG - Intergenic
1112977416 13:105337909-105337931 GTGAAAAGACAAAAGGAAAAGGG + Intergenic
1114003138 14:18283057-18283079 CTAAAAATACAAAAATTAAACGG - Intergenic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115241858 14:31257751-31257773 CTGAAAATACAAAAATTAACTGG - Intergenic
1115554157 14:34531141-34531163 CTAAAAATACAAAAAGTAACCGG + Intronic
1115583214 14:34783495-34783517 CTAAAAATACAAAAAGTAACCGG - Intronic
1115593816 14:34889839-34889861 CTGAAAATACAAAGATTAACTGG + Intergenic
1115738348 14:36359889-36359911 CTGAAAAATCACATGGCAAAGGG - Intergenic
1115777282 14:36729824-36729846 CTGAAAATGGTCATGGTAAATGG - Intronic
1115956807 14:38790316-38790338 CTAAAAATACAAAAGTTAACTGG - Intergenic
1115978906 14:39028334-39028356 ATGAAAATAAAAATGTAAAATGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116643043 14:47489572-47489594 CTGATAATCCAAACAGTAAATGG + Intronic
1116983799 14:51198179-51198201 CTCAAAATACTCATGGTGAAGGG - Intergenic
1117158881 14:52968106-52968128 CTGAAAATACAAAAAGTAGCTGG - Intergenic
1118132445 14:62982165-62982187 CTAAAAATACAAATATTAGATGG + Intronic
1118180106 14:63483919-63483941 CTAAAAATACAAAAAGTAGACGG + Intronic
1118416175 14:65538756-65538778 CTAAAAATACAAAAGTTAAGTGG + Intronic
1118555549 14:67015757-67015779 CTGAAAATTCAAAGAATAAATGG + Intronic
1119029215 14:71178482-71178504 CTGAAAATACAAATATTAGCTGG - Intergenic
1119375372 14:74186915-74186937 CTGAAAATACAAATATTAGCCGG + Intronic
1119493728 14:75060903-75060925 CTAAAAATACAAAAGTTAACTGG + Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119751288 14:77079459-77079481 CTAAAAATACAAATAGTAGCTGG - Intergenic
1120050128 14:79856398-79856420 CTGAAAATTCACATGATAAGGGG - Intronic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1121102906 14:91262429-91262451 CTGAAAATACAAAAGTTAGCCGG - Intergenic
1121180341 14:91924218-91924240 CTCAACACATAAATGGTAAATGG + Intronic
1121198356 14:92095779-92095801 CTAAAAATACAAATATTAACTGG + Intronic
1121501130 14:94439203-94439225 CTGAAAATATAAATTTTAGATGG + Intergenic
1121529029 14:94639772-94639794 TTGAAAAAACAAATGGTTCATGG - Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123486253 15:20742244-20742266 CTAAAAATACAAAAAGTAATCGG - Intergenic
1123542744 15:21311300-21311322 CTAAAAATACAAAAAGTAATCGG - Intergenic
1123896292 15:24833496-24833518 CTGAAAAATCAACTGGCAAAAGG + Intronic
1123901721 15:24883848-24883870 CTGAAAATACAAAAATTAACCGG + Intronic
1124712488 15:32027593-32027615 CTGAAAATACAAATATTAATCGG - Intergenic
1124825890 15:33095184-33095206 CTGAAAATACAAAAAGTAACTGG + Intronic
1125598359 15:40901742-40901764 CTGAAAATACAAAAGTTAGCTGG + Intronic
1125652138 15:41325998-41326020 CTGAAAATACAAAAGTTAGCTGG + Intronic
1126059507 15:44766604-44766626 AAGAAAATACAAATGCCAAAGGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1127117929 15:55745349-55745371 CTAAAAATACAAAAGTTAATTGG + Intergenic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1127436258 15:58961222-58961244 CTAAAAATACAAATGTTAGCTGG - Intronic
1127454006 15:59141634-59141656 CTGAAAATACAGACGGTAGCTGG + Intronic
1127509778 15:59629088-59629110 CTGAAAATACAAAAGTTAGCTGG - Intronic
1127889932 15:63241179-63241201 CTGAAAATACCAAAGTTAACTGG + Intronic
1128018718 15:64371425-64371447 CTAAAAATACAAATATTAACTGG - Intronic
1128020260 15:64384293-64384315 CTGAAAATACAAAAGTTAGCTGG - Intronic
1128188089 15:65661737-65661759 TTGAAAATACAATTTGTAAATGG - Exonic
1128915175 15:71553486-71553508 CTGAAAATACAAAAATTAACTGG - Intronic
1129489353 15:75908432-75908454 CTAAAAATACAAAAAGTAACCGG - Intronic
1129912991 15:79243617-79243639 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1130333091 15:82936336-82936358 CTGAAAACACAACCTGTAAATGG - Intronic
1130342689 15:83012519-83012541 ATCCAAATACAAATGTTAAAGGG + Intergenic
1130396707 15:83508737-83508759 CTAAAAATACAAATATTAAGTGG - Intronic
1130695219 15:86124166-86124188 CTGAAAATACAAAATGTAGCGGG + Intergenic
1131183581 15:90256847-90256869 CTAAAAATACAAAAGTTAACTGG - Intronic
1131480358 15:92775408-92775430 CTGAAAATACAAAAGTTAGCTGG - Intronic
1131759584 15:95606063-95606085 CAGAAAAGCAAAATGGTAAAAGG + Intergenic
1131769577 15:95720932-95720954 CTGTAAATACAAAAGATAACAGG - Intergenic
1131775351 15:95790298-95790320 CAGAAAATGCAAGTGGTAGAAGG - Intergenic
1132069411 15:98762564-98762586 CTGAAAATACAAAAGTTAGCTGG + Intronic
1132308144 15:100833017-100833039 GTGAAAACACAAGTCGTAAATGG - Intergenic
1202951062 15_KI270727v1_random:38430-38452 CTAAAAATACAAAAAGTAATCGG - Intergenic
1132490306 16:225322-225344 CTGAAAATACAAAAGTTAGCCGG + Intronic
1132702440 16:1227794-1227816 CTGAAAATACAAAAATTAACTGG + Intronic
1132705883 16:1243074-1243096 CTGAAAATACAAAAATTAACTGG - Intergenic
1132856871 16:2049245-2049267 CTAAAAATACAAAAATTAAATGG - Intronic
1133012026 16:2918600-2918622 CTGAAAATACAAAAATTAGATGG - Intronic
1133096064 16:3446770-3446792 CTAAAAATACAAAAATTAAATGG - Intronic
1133242315 16:4422387-4422409 CTGAAAATACAAAAGTTAGCCGG - Intronic
1133343157 16:5051936-5051958 CTGAAAATACAAATATTAGCCGG + Intronic
1134372619 16:13639343-13639365 CTAAAAATACAAAAGTTAACTGG + Intergenic
1134631198 16:15757345-15757367 CTGAAAATACAAAAGTTAGGTGG + Intronic
1134905877 16:17979074-17979096 CTAAAAATACAAAAAGTAACCGG - Intergenic
1135334010 16:21585796-21585818 CTAAAAATACAAATATTAACCGG - Intergenic
1135511663 16:23090059-23090081 CTGAAAATACACATATGAAATGG + Intronic
1135570226 16:23543569-23543591 CTAAAAATACAAAAATTAAATGG + Intronic
1135603002 16:23799202-23799224 CTGAAAATACAAATATTAGCTGG + Intergenic
1135819461 16:25669558-25669580 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1136061197 16:27727650-27727672 CTGAAAATGCAAATGGTCATAGG - Intronic
1136249989 16:28998132-28998154 CTAAAAATACAAAAAGTAACCGG + Intergenic
1136404437 16:30035922-30035944 CTGAAAATACAAATATTAGCTGG - Intronic
1136467804 16:30457087-30457109 CTGAAAATACAAAAATTAGAGGG + Intergenic
1137516777 16:49151744-49151766 ATGAAATTACAAATGAAAAAAGG + Intergenic
1138177644 16:54915925-54915947 CTAAAAATACAAAAAGTAACTGG - Intergenic
1138388600 16:56653464-56653486 CAGAAAATAAAAATGAGAAATGG - Intronic
1138564431 16:57822533-57822555 CTGAAAATACAAAAAGTAGCTGG + Intronic
1138708308 16:58940334-58940356 CTGAAAATACAAAAATTAACCGG - Intergenic
1138725464 16:59133676-59133698 CTGAAAATACAAAAGTTAGTTGG - Intergenic
1138786835 16:59856477-59856499 CTGAAAAGTCAATTGGCAAAAGG - Intergenic
1138995212 16:62443236-62443258 CTGAAAATACAAAAAGTAGCAGG + Intergenic
1139048887 16:63098746-63098768 CTGAAAATACAAAAATTAACCGG + Intergenic
1139241775 16:65399630-65399652 ATGAAAATACAGAAGTTAAAAGG - Intergenic
1139427547 16:66892177-66892199 CTAAAAATACAAAAATTAAATGG + Intronic
1139665965 16:68456460-68456482 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1139872379 16:70117929-70117951 CTAAAAATACAAAAAGTAACTGG + Intronic
1139895225 16:70283233-70283255 CTAAAAATACAAAAAGTAACTGG + Intronic
1140132026 16:72171231-72171253 CAGAAAATACTAAAGGTTAAAGG - Exonic
1140388021 16:74559760-74559782 CTGAAAATACATATGTCAGAAGG - Intronic
1140470484 16:75211400-75211422 CTAAAAATACAAATAGTAGCCGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140868421 16:79084574-79084596 CTGAAAATACAAAAAGTAGCCGG - Intronic
1141058709 16:80843472-80843494 CTAAAAATACAAAAGTTAACTGG + Intergenic
1141062368 16:80885150-80885172 CTAAAAATACAAAAATTAAATGG + Intergenic
1141095534 16:81160281-81160303 CTGAAAATACAAAAAGTAGCTGG - Intergenic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1141629968 16:85282187-85282209 CTGAAAATACAAACATTAACTGG - Intergenic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1142630517 17:1223038-1223060 CTAAAAATACAAAAAGTAACCGG + Intronic
1142897429 17:2991004-2991026 CTAAAAATACAAAAAGTAACTGG - Intronic
1143126397 17:4643562-4643584 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144486159 17:15666081-15666103 GTGGAAATATAAAGGGTAAAGGG - Intronic
1144914861 17:18716211-18716233 GTGGAAATATAAAGGGTAAAGGG + Intronic
1145051662 17:19666613-19666635 CTAAAAATACAAATGTTAGCTGG + Intronic
1145318293 17:21748091-21748113 CTGAAAATACAAAAATTAGATGG + Intergenic
1145948353 17:28795304-28795326 CTAAAAATACAAAAGTTAACTGG - Intronic
1146875182 17:36404039-36404061 CTGAAAATACAAAAATTACAGGG + Intronic
1147006525 17:37407748-37407770 CTGAAAATACAAATATTAGCTGG - Intronic
1147064206 17:37908831-37908853 CTGAAAATACAAAAATTACAGGG - Intergenic
1147255673 17:39180101-39180123 CTGAAAATACAAAAATTAACTGG + Intronic
1147268637 17:39250810-39250832 CTTAAAAGACAAATGGTATCAGG + Intergenic
1147415079 17:40283023-40283045 CTGAAAATACAAAAATTAACCGG + Exonic
1147797447 17:43054909-43054931 CTAAAAATACAAAAGTTAACTGG - Intronic
1148405437 17:47409670-47409692 CTAAAATTACCAAAGGTAAACGG + Exonic
1149432834 17:56608139-56608161 CTGAAAATACAAAAGTTAGATGG - Intergenic
1149703815 17:58677285-58677307 CTAAAAATAAAAATGCTTAAAGG + Intronic
1149815982 17:59724261-59724283 CTGAAAATAAGAAAGGAAAAAGG + Intronic
1150206085 17:63409029-63409051 GTGAAAATAGAAATGTTGAAGGG + Intronic
1150520228 17:65859276-65859298 CTGAAAATACAAAAAGTAGCTGG + Intronic
1150526982 17:65934025-65934047 CTAAAAATACAAAAGTTACATGG + Intronic
1150648356 17:66993765-66993787 CTGAAAATACAAAAGTTAGCCGG - Intronic
1151119666 17:71778770-71778792 CTGAACATATAAATGTTATAAGG + Intergenic
1151643267 17:75412050-75412072 CTGGGAATACAAATGTGAAAAGG - Intergenic
1151885708 17:76922241-76922263 CTGAAAATACAAACCGTAGGTGG - Intronic
1151904858 17:77041066-77041088 CTGAAAATTCACATGATAAAAGG - Intergenic
1151999879 17:77638603-77638625 CTGAAAATACAAAAATTAACAGG + Intergenic
1152005702 17:77679110-77679132 CTAAAAATACAAAAAGTAACTGG - Intergenic
1152445939 17:80343655-80343677 CTAAACATAAAAATGGTACAGGG + Intronic
1152501356 17:80711903-80711925 CTGAAAATACAAATATTAGCCGG - Intronic
1203168385 17_GL000205v2_random:121414-121436 CTGAAAATACAAAAGTTAGCCGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153007872 18:513477-513499 CTGAAAATACAAAAATTAGACGG - Intergenic
1153148337 18:2058751-2058773 CTGAAAATACAAAAATTAGATGG - Intergenic
1153441815 18:5128168-5128190 ATTAAAATTAAAATGGTAAAGGG + Intergenic
1154533993 18:15378789-15378811 CTAAAAATACAAAAATTAAACGG + Intergenic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155412557 18:25562590-25562612 CTAAAAATACAAAAAGTAACTGG - Intergenic
1155452577 18:25978223-25978245 CTGAAAATACAAAACTTAACCGG + Intergenic
1155550685 18:26961939-26961961 CTGGAAATACAAAGGCGAAAGGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155806989 18:30183852-30183874 CTGAAAATATAATTGAAAAATGG + Intergenic
1156356485 18:36346457-36346479 ATGTTAATGCAAATGGTAAATGG + Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1156709023 18:39919351-39919373 CTTAAAATACAAATAGTGAAGGG + Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1156904880 18:42340730-42340752 CTGAAAAATCAACTGATAAAGGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157371385 18:47115579-47115601 CTGAAACCACTAAAGGTAAAAGG - Intronic
1157383441 18:47242043-47242065 ATGGAAATATAAATGCTAAAAGG - Intronic
1157560627 18:48643199-48643221 CTGAAAAATCAACTTGTAAAAGG + Intronic
1157777666 18:50408502-50408524 TTGAAAAGACAAATGGTTACAGG - Intergenic
1157843931 18:50984768-50984790 CTAAAAATACAAAAAGTAACTGG + Intronic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158412156 18:57216720-57216742 CTGAAAATACAAAAATTAACTGG + Intergenic
1158610834 18:58939083-58939105 CTAAAAATACAAAAAGTAATTGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158837327 18:61344827-61344849 CAGAAAATTCCAATGGTCAAGGG + Intronic
1159006331 18:63016116-63016138 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159032028 18:63241268-63241290 CAGAAAACATAAATGTTAAAGGG + Intronic
1159200414 18:65176364-65176386 TTGATAATAATAATGGTAAAAGG + Intergenic
1159574951 18:70163817-70163839 CTGAAAATCCAAAATCTAAAAGG - Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160215205 18:76922716-76922738 CTGAAAATACAAAAATTAACAGG - Intronic
1160941936 19:1624232-1624254 CTGAAAATACAAAAAGTAGCCGG + Intronic
1161185834 19:2919787-2919809 CTGAAAATACAAAAGTTAGCGGG - Intergenic
1161510224 19:4666435-4666457 CTGAAAATACAAAAGTTAGCAGG - Intronic
1161837263 19:6656339-6656361 TTAAAAAGATAAATGGTAAAAGG + Intergenic
1162146593 19:8616101-8616123 CTAAAAATACAAAAGTTAGACGG + Intergenic
1162175773 19:8829098-8829120 CTGAAAATACAAAAATTAACCGG + Intronic
1162578894 19:11515793-11515815 CTAAAAATACAAAAGTTAACTGG - Intronic
1162690061 19:12422198-12422220 CTGAAAATACAAAACTTAACTGG - Intronic
1163015838 19:14453732-14453754 CTAAAAATACAAAAGTTAACCGG + Intronic
1163389111 19:17019282-17019304 CTAAAAATACAAAAGTTAACTGG - Intronic
1163431722 19:17272100-17272122 CTAAAAATACAAAAATTAAACGG - Intronic
1163457174 19:17414117-17414139 CTGAAAATACAAAAATTAGATGG + Intronic
1163521087 19:17792414-17792436 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1163572077 19:18088222-18088244 CTGAAAATACAAAAATTAACCGG + Intronic
1164187034 19:22879469-22879491 CAGAAAATACCAATAGTAACTGG + Intergenic
1164207875 19:23073025-23073047 CTAAAAATACAAATATTAACCGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165340469 19:35208218-35208240 CTGAAAATACAGAAAGGAAATGG + Intergenic
1165383110 19:35494917-35494939 ATTAAAATACAAATTTTAAAAGG + Intronic
1165572929 19:36790952-36790974 CTGAAAATACAAAAATTAGACGG + Intergenic
1165750999 19:38259809-38259831 CTGAAAATATAAAAAGTAAGCGG - Intronic
1165790159 19:38486503-38486525 CTGAAAATACAAATATTAGCGGG - Intronic
1166027634 19:40102942-40102964 CTAAAAATACAAAAGTTAGATGG + Intergenic
1166148897 19:40856613-40856635 CTAAAAATACAAAAGTTAGATGG - Intronic
1166205521 19:41266269-41266291 CTAAAAATACAAATATTAACCGG + Intronic
1166609610 19:44179016-44179038 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1166889135 19:45979649-45979671 CTGAAAATACAAAAATTAACCGG - Intergenic
1166890214 19:45987177-45987199 CTGAAAATACAAAAATTAGATGG - Intergenic
1167065736 19:47184570-47184592 CTAAAAATACAAAAACTAAATGG - Intronic
1167139341 19:47638814-47638836 CTGAAAATACAAATACTAGCCGG - Intronic
1167501089 19:49848723-49848745 CTAAAAATACAAAAGTTAACCGG - Intergenic
1167841718 19:52127214-52127236 CTGAAAATACAAATATTAGCCGG - Intronic
1167923303 19:52802514-52802536 CTGAAAATACAAAAAGTAGCTGG + Intronic
1168001073 19:53446532-53446554 CTAAAAATACAAAAAGTAACTGG - Intronic
1168043853 19:53780031-53780053 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1168081025 19:54010545-54010567 TTGAAAATAAAAAGGGGAAATGG - Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
1168505848 19:56934240-56934262 CTGAAAATACAAAAATTAACCGG - Intergenic
1168529404 19:57115883-57115905 CTAAAAATACAAAAGTTAGATGG + Intergenic
1202655619 1_KI270708v1_random:17863-17885 CTGAAAATACAAAAATTAACTGG - Intergenic
1202677648 1_KI270711v1_random:22247-22269 CTAAAAATACAAAAAGTAGATGG - Intergenic
1202678432 1_KI270711v1_random:28593-28615 CTAAAAATACAAAAAGTAGATGG - Intergenic
925539111 2:4947372-4947394 CTAAAAATACAAATAATAAATGG - Intergenic
925642072 2:5995043-5995065 CTGAAAGTTCAAGTGTTAAATGG + Intergenic
925860129 2:8166784-8166806 TGGAAAATACATATTGTAAAAGG - Intergenic
925962460 2:9030486-9030508 TTGATAATACAACTAGTAAAGGG + Intergenic
926038003 2:9649983-9650005 CTAAAAATACAAAAAGTAACTGG + Intergenic
926297081 2:11576871-11576893 CTGAAAATACAAAAGTTAGCCGG + Intronic
926372615 2:12195316-12195338 TTTAAAATACAAATTGAAAATGG + Intergenic
926466938 2:13202470-13202492 CTAAAAATACAAATATTAACTGG + Intergenic
926491894 2:13534039-13534061 CTAAAAATGTAAATGGAAAATGG + Intergenic
926527355 2:13997495-13997517 CTGAACAAAAAAATGCTAAAGGG + Intergenic
927350756 2:22111056-22111078 ATGAAAATAAAAATGGGAGAGGG - Intergenic
927378710 2:22451620-22451642 CTGAAAGTACTAATGTTAAATGG - Intergenic
928156168 2:28879173-28879195 CTGAAAATACAAAAATTAACTGG - Intergenic
928156221 2:28879557-28879579 CTGAAAATACAAAAATTAACTGG - Intergenic
928238323 2:29564619-29564641 TTAAAAATAGAAATGATAAAAGG + Intronic
928711456 2:34011260-34011282 GTTAAAGTCCAAATGGTAAAAGG + Intergenic
928752694 2:34488917-34488939 GTGAAAATGCAAATTATAAAAGG - Intergenic
928808077 2:35186141-35186163 CTTAAAATAGATAAGGTAAAAGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929083448 2:38144923-38144945 GTGAAATTACAAATGTTATAGGG - Intergenic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
929659216 2:43766757-43766779 CTAAAAATACAAATATTAGATGG - Exonic
930549817 2:52819321-52819343 CTGAAAATTGAAATGCTAGATGG - Intergenic
930623902 2:53674710-53674732 ATGAAAATAAAAATGGTAGTAGG - Intronic
930695528 2:54407758-54407780 CTGAAAAATCAACTGATAAAAGG - Intergenic
930712788 2:54564767-54564789 CTGAAACTTCAAATCTTAAAAGG - Intronic
930792362 2:55347771-55347793 CTGAAAATACAAAAATTAATTGG - Intronic
931287155 2:60841823-60841845 CTAAAAATACAAAAAGTAGACGG + Intergenic
931823906 2:65979580-65979602 CCAAAAATACAAAATGTAAATGG - Intergenic
931971929 2:67597567-67597589 CTGAAAATACAAAAGTTAGCTGG - Intergenic
931987323 2:67754653-67754675 CTGAAAATACAAAAATTAACTGG - Intergenic
932687817 2:73888055-73888077 CTGAAAATACAAAAGTTAGCTGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933709060 2:85312349-85312371 CTAAAAATACAAAAAGTAACTGG + Intergenic
933786986 2:85851076-85851098 CTGAAAATACAAAAAGTAGCCGG - Intronic
933862220 2:86481412-86481434 CTAAAAATACAAATGTTAGCAGG - Intronic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934313018 2:91887118-91887140 ATGAAAATAAAAATAGAAAAAGG + Intergenic
935048916 2:99507247-99507269 CTAAAAATACAAATATTAGAAGG - Intergenic
935086820 2:99855179-99855201 ATGAAGATATAAAGGGTAAAGGG + Intronic
935094562 2:99931996-99932018 CTGAAAAACAAAATGTTAAATGG + Intronic
935162010 2:100537494-100537516 CTGAAAATACAAAAAGTAGCTGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935458783 2:103302826-103302848 CTGAAAATACAAAAGTTAGCTGG - Intergenic
935490078 2:103708551-103708573 CTGAAAAAAGAAATCTTAAATGG + Intergenic
935508145 2:103932859-103932881 CTGAAAATACAAAAGTTAGCCGG + Intergenic
935664937 2:105502970-105502992 ATGAAAATACAAATGGGGTAGGG - Intergenic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
935826845 2:106960757-106960779 CTGAAAAGACAAAAGACAAAAGG + Intergenic
936644374 2:114351675-114351697 CTGCAAAGACACATGGCAAAGGG - Intergenic
936791334 2:116157040-116157062 CAGAAAAAACAATTGATAAAAGG + Intergenic
937417387 2:121726675-121726697 CTAAAAATACAAAAATTAAATGG - Intergenic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937921563 2:127135237-127135259 CTGAAAGTAAAAAGGGGAAAAGG - Intergenic
938054308 2:128202381-128202403 CTGAAAATACAAAAGCTAGCCGG + Intergenic
938159947 2:128976207-128976229 CTAAAAATACAAAAGTTAGATGG + Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938532739 2:132205994-132206016 CTAAAAATACAAAAATTAAACGG + Intronic
938839440 2:135144726-135144748 CACAAAACACAAATGGCAAATGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939090524 2:137775382-137775404 CTGAAAAATCAAATTGCAAAAGG + Intergenic
939334473 2:140807928-140807950 CTGAAAATACAAAAATTAACCGG + Intronic
939347926 2:140991855-140991877 ATAAAAATAAAAAGGGTAAATGG + Intronic
939622781 2:144440707-144440729 CTAAAAATTTAAAGGGTAAAGGG - Intronic
939697632 2:145346236-145346258 AGGTAAATACAAATGGGAAATGG + Intergenic
940055678 2:149510404-149510426 CTAAAAATACAAAAAGTAACTGG - Intergenic
940075974 2:149742806-149742828 ATGAAAGGACAAATGGCAAAAGG + Intergenic
940386088 2:153073868-153073890 CTTAAAAAACAAATTATAAAGGG - Intergenic
940497082 2:154444822-154444844 CTGCAAATAAAAAAGTTAAATGG + Intronic
940528385 2:154845807-154845829 CTGAAAATACAAAAATTAACTGG + Intronic
940738872 2:157484369-157484391 CTGAGAATCCACATGGGAAATGG + Intronic
940800288 2:158125581-158125603 CTGAAAATACAAAAGTTAGCCGG - Intronic
941277425 2:163507617-163507639 CTGAAAATACAAATATTAGCTGG + Intergenic
941507416 2:166364578-166364600 ATGAAAAGACAAATGCTATAGGG + Intronic
941727035 2:168872127-168872149 CTGAAAATACAAAAGTTAGCTGG - Intronic
941750086 2:169126260-169126282 CTGTACATAGAAATGGGAAAAGG - Intergenic
941778325 2:169416907-169416929 CTAAAAATACAAAAAGTAACCGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942026727 2:171918089-171918111 CTGAAAATACAAAAATTAACCGG - Intronic
942183733 2:173404666-173404688 TTGAGAATAGAAATGGCAAAAGG + Intergenic
942591093 2:177547696-177547718 GTGAAATTAGAAAGGGTAAATGG - Intergenic
942672792 2:178394510-178394532 ATGAAAATAAAATGGGTAAATGG + Intronic
942692637 2:178602694-178602716 ATTAAAATAGAAATGCTAAAAGG + Intronic
942964381 2:181873515-181873537 CTGGAAATAAAACTGATAAATGG - Intergenic
943070224 2:183132390-183132412 CTGAAAATACAAAAAAAAAAAGG + Intronic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
943405510 2:187478196-187478218 CTGAAAATACAAATATTAGCGGG + Intronic
943464197 2:188208390-188208412 CTTATAATATAAATGATAAATGG - Intergenic
943843919 2:192616473-192616495 CTGAAAATACAAAAAGTAGCTGG + Intergenic
944100455 2:196020770-196020792 CTGAAAATACAAAAGTTAGCTGG - Intronic
944239553 2:197472640-197472662 CTGAAAATACAAAAATTAACTGG + Intronic
944632301 2:201639632-201639654 CTGAAAATACAAAAAGTAGCTGG + Intronic
944736653 2:202572887-202572909 CTGAAAATACAAAAATTAACCGG + Intergenic
944781645 2:203024394-203024416 CTGAAAATACAAAAGTTAGCTGG + Intronic
944860709 2:203813398-203813420 CATAAAATACAAAATGTAAAGGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945770621 2:214037347-214037369 TTTAAAATAAAAAAGGTAAAAGG - Intronic
946672210 2:222117031-222117053 GTGAAAACACAAATGTTGAATGG + Intergenic
946684045 2:222249391-222249413 CTGAAGATGAAAATGGGAAAAGG - Intronic
947030754 2:225791132-225791154 CTGAAAATACAAATATTAGCCGG - Intergenic
947383643 2:229569358-229569380 CTAAAAATACAAAAGTTAACAGG + Intronic
947401822 2:229738741-229738763 CTTAAAATATATATAGTAAAAGG + Intergenic
947579371 2:231304066-231304088 CTGAAAATACAAAAGTTAGCTGG + Intronic
947596534 2:231415666-231415688 CTGAAAATACAAAAGTTATCCGG + Intergenic
948317385 2:237038888-237038910 CTGAAAATACAAAAGTTAGCCGG - Intergenic
948407652 2:237734440-237734462 CTGAAAACACAAAAAGTAACTGG - Intronic
948420011 2:237852372-237852394 CTAAAAATACAAAAATTAAATGG - Intergenic
948543422 2:238706161-238706183 CTGCAAATAAAGATGGTAAGTGG + Intergenic
948557894 2:238827887-238827909 CTTATATTACAAAAGGTAAAAGG + Intergenic
948871494 2:240801260-240801282 CAGAGAATATAAATGGAAAATGG + Intronic
948891941 2:240911457-240911479 CTGAAAATACAAAAAATAACTGG - Intergenic
1168744515 20:226834-226856 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1168812393 20:712870-712892 CTAAAAATACAAATATTAACTGG - Intergenic
1168866782 20:1093310-1093332 CTAAAAATACAAAAGTTAACTGG - Intergenic
1169044463 20:2524784-2524806 CTCAAAATAAAAATAGTAAGAGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169355555 20:4902010-4902032 CTCAAAAAACAAATGATGAATGG - Intronic
1169655396 20:7917176-7917198 CTGAAAATACAAATATTAGCTGG + Intronic
1170229063 20:14025218-14025240 CAGACAATAAAAATGATAAAGGG - Intronic
1170686925 20:18577642-18577664 CTAAAAATACAAATGTTAGCCGG + Intronic
1171463848 20:25314132-25314154 CTGAAAATACAAAAATTAACCGG - Intronic
1171759614 20:29165229-29165251 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1172241900 20:33418629-33418651 CTGAAAATACAAAAGCTAGCCGG + Intronic
1172250267 20:33474537-33474559 CTCTAAATACAAACAGTAAAAGG - Intergenic
1173399124 20:42709032-42709054 CTGAAAATCCAAATACTACATGG + Intronic
1174348544 20:49949804-49949826 CTGAAAGTACAAAAAGTAATGGG - Intronic
1175253211 20:57622198-57622220 CGGCAAATACAAATGGAAAGGGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175590544 20:60187438-60187460 CCCATAACACAAATGGTAAAGGG - Intergenic
1176157728 20:63630517-63630539 CTAAAAATACAAAAAGTAACTGG - Intergenic
1176295937 21:5072874-5072896 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1176325756 21:5448741-5448763 CTGAAAATACAAAAGTTAGCCGG - Intergenic
1176403372 21:6337721-6337743 CTGAAAATACAAAAGTTAGCCGG + Intergenic
1176433785 21:6651383-6651405 CTGAAAATACAAAAGTTAGCCGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176641306 21:9306294-9306316 CTGAAAATACAAAAATTAACTGG - Intergenic
1176924291 21:14728385-14728407 CTGAAAAAAAAATTTGTAAATGG - Intergenic
1177380384 21:20333668-20333690 CTAAAAATACAAAAGTTAGATGG + Intergenic
1177648043 21:23924453-23924475 CTGAAAATACAAAAAGTAGCTGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177864930 21:26500966-26500988 TTGAAAATCTAAATGGTACATGG - Intronic
1178566340 21:33689804-33689826 CTGAAAATACAAAAGTTAGCCGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178906357 21:36640227-36640249 CTAAAAAAAAAAATGCTAAAAGG + Intergenic
1178963360 21:37089673-37089695 CTAAAAATACAAAAGTTAACTGG - Intronic
1178997767 21:37420908-37420930 ATAAAAATACAAATGACAAAAGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179198798 21:39194107-39194129 CTGAAAGAAAAAATGGTAATTGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861110 21:44189247-44189269 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180350324 22:11795651-11795673 CTGAAAATACAAAAATTAACTGG - Intergenic
1180374613 22:12079087-12079109 CTGAAAATACAAAAATTAACTGG - Intergenic
1180387889 22:12196416-12196438 CTGAAAATACAAAAATTAACTGG + Intergenic
1180427653 22:15213858-15213880 CTAAAAATACAAAAATTAAACGG - Intergenic
1180510906 22:16088257-16088279 CTAAAAATACAAAAATTAAACGG - Intergenic
1180726696 22:17951856-17951878 CTGAAAATACAAAAATTAACCGG - Intronic
1180878481 22:19186760-19186782 CTGAAAATACAAAAGTTAGCCGG - Intronic
1181492042 22:23266549-23266571 CTGAAAATACAAAAATTAGACGG - Intronic
1182016799 22:27047179-27047201 CTGAAAAGACACATTGCAAATGG + Intergenic
1182314136 22:29432390-29432412 TTGAAAAGACAAATGGTTACAGG - Intergenic
1182499309 22:30734134-30734156 CTAAAAATACAAAAATTAAATGG - Intronic
1182648400 22:31829368-31829390 CTGAAAATACAAATATTAGCTGG + Intronic
1183152369 22:36047886-36047908 CTGAAAATACAAATATTAGCTGG - Intergenic
1184553453 22:45218503-45218525 CTGAAAAGACAATGGGTGAAAGG - Intronic
1185408337 22:50670173-50670195 CTGAAAATACAAAAATTAACTGG + Intergenic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951098581 3:18660087-18660109 CTAAAAAAAAAAATGATAAAAGG - Intergenic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951677418 3:25257930-25257952 GTGGAAATACAAATGATGAAGGG - Intronic
952592404 3:34972806-34972828 CTTAAAATACAAATGTGGAAAGG + Intergenic
952842891 3:37663173-37663195 CTGAAAATTCCATTTGTAAAAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953121521 3:40047421-40047443 CTTAAAATAAAAATGGAACAAGG - Intronic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953332747 3:42067832-42067854 TTGAAAATTCACATGGAAAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954176559 3:48849788-48849810 CTGAAAATACAAAAATTAACTGG - Intergenic
954288058 3:49633138-49633160 CTGAAAATACAAAAGTTAGCTGG + Intronic
954347993 3:50016985-50017007 CTAAAAATACAAAAGTTAACTGG - Intronic
954528277 3:51293592-51293614 ATGAAAATAAAAATAGAAAATGG + Intronic
955393920 3:58542037-58542059 CTAAAAATACAAAAGATAACTGG - Intergenic
955459155 3:59161480-59161502 CTAAAAATACAAATGTTAGCTGG + Intergenic
955494403 3:59516690-59516712 TTGAAATGACAAATGGTGAAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955936984 3:64111439-64111461 CTGTGAATACAAAAAGTAAAAGG + Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956311816 3:67889151-67889173 CTGAAAATACAAAAGTTAGCTGG + Intergenic
956435339 3:69229865-69229887 CTGAAAATACAAAAAGTAGCTGG - Intronic
956559393 3:70557656-70557678 ATGAAAATAGAAATAGTAAGTGG + Intergenic
956633009 3:71334517-71334539 CTGAAACTACATATTGCAAAAGG + Intronic
956817279 3:72919591-72919613 CTAAAAATACAAAAAGTAACTGG + Intronic
957098850 3:75804254-75804276 CTGAAAATACAAAAATTAACTGG + Intergenic
957573869 3:81984796-81984818 CTGAAAATACAAATATTAGCCGG - Intergenic
957849765 3:85792072-85792094 GTGAAAACACAAATGCTAAATGG - Intronic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
958085151 3:88797080-88797102 CTGAAAATGCAACTGGCATATGG - Intergenic
958136279 3:89497865-89497887 CTGAAATTACAAAAGGAATAAGG + Intergenic
959124737 3:102277275-102277297 CTGAAAATACAAAAATTAACCGG - Intronic
959202120 3:103260487-103260509 ATGAAAAGACAAAAGCTAAAAGG + Intergenic
959220257 3:103509360-103509382 TTAAAAATAAAACTGGTAAAGGG - Intergenic
959327433 3:104955589-104955611 CTAAAAATACAAAAGCTAACCGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960344342 3:116513958-116513980 CTGAAAAATCAAATGGCTAAAGG + Intronic
960798171 3:121510920-121510942 CTGAAAATACAAAAATTAACTGG + Intronic
961576342 3:127839862-127839884 CTAAAAATACAAAAACTAAATGG + Intergenic
961610604 3:128134299-128134321 CTAAAAATACAAATGTTACCTGG + Intronic
962116366 3:132513138-132513160 CTCAAATTACACATGGTAAGTGG - Intronic
962286807 3:134093265-134093287 CTAAAAATACAAAAAGTAACCGG - Intronic
962360192 3:134734357-134734379 GTGAAAATACCAATCTTAAAAGG + Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963385631 3:144589332-144589354 ATGAAAAAAAAAATGGAAAAAGG - Intergenic
963564771 3:146915506-146915528 TTAAAAATACAAATTGTAGAAGG - Intergenic
964043050 3:152287054-152287076 CTGAAAATACAAAAAGTAGCCGG + Intronic
964105198 3:153031615-153031637 TTGAAAATACTAACTGTAAAGGG - Intergenic
964157608 3:153604838-153604860 AAGAAAAAAGAAATGGTAAACGG - Intergenic
964229323 3:154444870-154444892 CTGAAAATACAAAAAGTAGCCGG + Intergenic
965195769 3:165592025-165592047 CTAAAAATACAAAAGTTAACAGG + Intergenic
965207056 3:165734168-165734190 TTTAAAAAACAAATGGGAAAAGG - Intergenic
965235587 3:166116213-166116235 CTAAAAATAAAATTGCTAAATGG - Intergenic
965516391 3:169626007-169626029 TTGGAAATAAAAGTGGTAAATGG - Intronic
965591706 3:170366516-170366538 CTGAAAATACAAAAGTTAGCAGG + Intronic
965755105 3:172017752-172017774 CTAAAAATACAAAAATTAAATGG + Intergenic
965930351 3:174035143-174035165 TTGAAAATACAATTGGTGAGTGG + Intronic
966174309 3:177119131-177119153 CTAAAAATACAAATAGTAGCCGG - Intronic
966293281 3:178386289-178386311 CTAAAAATACAAAAATTAAACGG - Intergenic
966409341 3:179632476-179632498 CTAAAAATACAAAAATTAAATGG - Intergenic
967081714 3:186055698-186055720 CTAAAGATTCAAATGGGAAAAGG - Intronic
967163751 3:186761956-186761978 CTGAAAATACAAAAAGTAGCCGG - Intergenic
967506343 3:190257137-190257159 CTTAAAATAAAAAGGATAAAAGG + Intergenic
967780806 3:193437309-193437331 CAGGAAATAAAAAGGGTAAAAGG - Intronic
1202745589 3_GL000221v1_random:98728-98750 CTGAAAATACAAAAATTAACTGG + Intergenic
968769691 4:2496620-2496642 CTGAAAATACAAAAGTTAGCTGG - Intronic
970196992 4:13560975-13560997 CTAAAAATACAAAAAGTAACCGG - Intergenic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
970457175 4:16236461-16236483 CTGCAAATACAAATATTACAAGG + Intergenic
970713872 4:18897377-18897399 CTAAAAATACAAAGGTTAATTGG + Intergenic
970849068 4:20580220-20580242 CTGAAAATACAAAAAATAACTGG - Intronic
970996908 4:22278192-22278214 CTGAAAATAGAAATGTTGTAGGG + Intergenic
971096059 4:23404763-23404785 ATGAAAATAGCAATGGGAAAAGG - Intergenic
971199178 4:24496473-24496495 CTAAAAATACAAAAATTAAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971350494 4:25851725-25851747 CTAAAAATACAAATATTAACCGG + Intronic
971663715 4:29455396-29455418 CTAAAAATACAAAAGTTAGAAGG + Intergenic
972106189 4:35491702-35491724 CTGAAAATACAATTTGGAAATGG + Intergenic
972152248 4:36107510-36107532 TTGAAAATTCAAGTGGTTAAAGG - Intronic
972348483 4:38213378-38213400 CGGGAAATACAAATTGGAAAGGG + Intergenic
972352276 4:38246757-38246779 CTGAAAAGGCAAATGATATAGGG - Intergenic
972553631 4:40159333-40159355 CCCAAAATACTAATGGCAAAAGG + Intergenic
972673842 4:41240310-41240332 CTGAAAATACAAAAGTTAGCTGG + Intergenic
972722012 4:41709116-41709138 CTGAAGTCACAAATGGTAAGTGG - Intergenic
972801023 4:42475875-42475897 CTGAAAATACAAAAGTTAGCTGG + Intronic
972819067 4:42678445-42678467 CTGAGAAAAAAAATTGTAAAGGG + Intergenic
973042493 4:45488592-45488614 CTAAAAATACAAATGTTAGCTGG - Intergenic
973259821 4:48151646-48151668 CTGAAAATACAAATATTAGCTGG - Intronic
974007232 4:56570963-56570985 CTAAAAATACAAAAGTTAACGGG - Intronic
974145328 4:57939867-57939889 CAGAAAATACATTTGGTTAATGG - Intergenic
974298589 4:60035733-60035755 CTAAAAATACAAAAAGTAGACGG - Intergenic
974783230 4:66582672-66582694 CTGAAAATACAAAAAGTAGCTGG - Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975454313 4:74572215-74572237 CTGACAATCCAAATGATAAAGGG + Intergenic
975701062 4:77067068-77067090 CTGAAAATACAAAAATTAACTGG + Intronic
975791449 4:77956891-77956913 TAGAAATTATAAATGGTAAAGGG + Intergenic
976023562 4:80661162-80661184 CTGAAAATACAAAAATTAATCGG + Intronic
976199351 4:82563057-82563079 CTGAAAATACAAAAATTAATCGG - Intergenic
976418034 4:84802107-84802129 CTAAAAATACAAAAGTTAACTGG - Intronic
976455444 4:85241379-85241401 CTGAAAATACAAAAATTAACTGG + Intergenic
976631239 4:87238767-87238789 CTGGAAATACATATGATAGAAGG + Intronic
977219077 4:94317510-94317532 CAGAAAATACATATGGCATATGG - Intronic
977478770 4:97547114-97547136 CTAAAAATGAAAAGGGTAAAAGG + Intronic
977580398 4:98718433-98718455 CTGAAAATACAAAAACTAACCGG - Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978152346 4:105451957-105451979 CTGAAAATAAAAAAGATAAAAGG + Intronic
978266491 4:106832575-106832597 CTAAAAATACAAAAGGTAGGAGG + Intergenic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
978505717 4:109454017-109454039 CTAAAAATACAAAAATTAAACGG - Intronic
978870042 4:113564899-113564921 CAGAAAATACAAAATGTAATAGG + Intronic
979065085 4:116121492-116121514 TTGAAAATACAAATACTAATTGG + Intergenic
979066053 4:116134231-116134253 CTGAAAATCCAACTTGGAAAAGG + Intergenic
979129811 4:117029365-117029387 CTAAAATAACAAATGGGAAATGG - Intergenic
979395280 4:120180233-120180255 CTAAAAATACAAAAGTTAACTGG + Intergenic
979518919 4:121643588-121643610 CAGAAAATGGAAATGGGAAAAGG - Intergenic
979544695 4:121926566-121926588 CTGAAAATACAAAAGATAGCCGG - Intronic
979617792 4:122763741-122763763 CTGAAAATACAAAAAGTAGCTGG - Intergenic
979726312 4:123966612-123966634 CTAAAAATACAAAAGGTAGCTGG + Intergenic
979753505 4:124309762-124309784 CTGAAAATACAAAAATTAACCGG + Intergenic
980416927 4:132501363-132501385 CTAGAAATAAAAAAGGTAAATGG + Intergenic
980938650 4:139250736-139250758 TGGAAAAAACAAATTGTAAAAGG - Intergenic
981134743 4:141197541-141197563 TAGAAAATACAAATTGTAAAAGG - Intronic
981258557 4:142692160-142692182 CTGAAAAATCAACTGATAAAAGG + Intronic
981301834 4:143195831-143195853 CTGAAAATAGAACTGGTAAGTGG + Exonic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981511708 4:145565497-145565519 ATGAAACTACACATGGTACACGG - Intergenic
981709309 4:147693140-147693162 CTGAAAATACAAAAAATCAACGG + Intergenic
981741824 4:148010380-148010402 ATGAAAAAACCAATGGTTAAAGG - Intronic
981930727 4:150186285-150186307 TTTAAAAAATAAATGGTAAAAGG + Intronic
981940715 4:150278984-150279006 CTAAAAATACAAAAGTTAGACGG - Intronic
982057510 4:151567471-151567493 ATTAAAATTCTAATGGTAAAAGG - Intronic
982564882 4:156973380-156973402 CTGTAGATAGAAGTGGTAAAGGG - Intergenic
982728623 4:158931722-158931744 CTGAAAATACAAATGTTAGCTGG - Intronic
982848798 4:160284060-160284082 CTGAAGTTACAAATAGTAAATGG + Intergenic
983087415 4:163464360-163464382 CTAAAAATACAAAAGTTAACTGG - Intergenic
983903547 4:173162180-173162202 CTGAAAATACAAAAATTAGATGG + Intergenic
983932082 4:173463434-173463456 CTGAAAATACAAAATTTAACTGG - Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
984172137 4:176372325-176372347 CTAAAGACACAAATAGTAAAGGG - Intergenic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984272045 4:177558945-177558967 CAGAAAATACAACTGGTAACAGG + Intergenic
984663534 4:182400113-182400135 CTGAAAATGCATACAGTAAATGG - Intronic
985348212 4:189029809-189029831 CTTAAAATACAAATGATAAAGGG - Intergenic
1202756198 4_GL000008v2_random:64529-64551 CTGAAAATACAAAAATTAACTGG - Intergenic
985899212 5:2774301-2774323 CTAAAAATACAAAAAGTAACCGG + Intergenic
986059017 5:4170473-4170495 CTAAAAATACAAATGTTAGCTGG - Intergenic
986069275 5:4266150-4266172 CTGAAAATGCAAATGGTGCTGGG - Intergenic
986204217 5:5608518-5608540 CTAAAAATACAAAAATTAAATGG - Intergenic
986587028 5:9329160-9329182 CTGAAAACACCAAGAGTAAAGGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987503058 5:18737825-18737847 CTGAAAATACAAATATTAGCTGG - Intergenic
987539244 5:19232400-19232422 CAGAAAATACTAATGGTTGAAGG + Intergenic
987606528 5:20143185-20143207 CTAGAAATATAAATGTTAAAGGG + Intronic
987804215 5:22742017-22742039 CTAAAAATACAAAAGGTAGCTGG + Intronic
987850938 5:23353132-23353154 CTGAAAATACAAAAATTAGATGG - Intergenic
987895396 5:23939501-23939523 TTTTAAATAAAAATGGTAAAAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987953517 5:24706862-24706884 CTGAAAATGCAAATAGTACCCGG + Intergenic
988045459 5:25945781-25945803 TTGAAAAAAAAAATGGTGAAAGG + Intergenic
988090336 5:26531236-26531258 AAGAAAATAGAAATGTTAAAAGG - Intergenic
989640929 5:43582321-43582343 CTGAAAAATCAACTGATAAAAGG + Intergenic
990224473 5:53633890-53633912 CTGAAACTATAAATTGTAGATGG + Intronic
991578075 5:68125602-68125624 CTGACAAAACCAATGGGAAAAGG + Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992685504 5:79195558-79195580 CTGAAAATACAAAAAGTAGCTGG - Intronic
992691833 5:79248189-79248211 CTAAAAATACAAAAGTTAAAAGG - Intronic
992792394 5:80225100-80225122 CTAAAAATACAAATGTTAGCTGG - Intronic
992907511 5:81360914-81360936 CTAAAAATACAAAAAGTAACCGG + Intronic
992922651 5:81543014-81543036 CTAAAAATACAAAAATTAAATGG - Intronic
992929231 5:81624489-81624511 CTGAAAATCCAAATTCTAAAAGG + Intronic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
993331573 5:86606660-86606682 CTGAAAATACAAAAATTAGATGG - Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
993394293 5:87364078-87364100 CTGATAATACTAATGGTGAAAGG - Intronic
993605451 5:89985344-89985366 GTCAAAATACAAATAGTCAAAGG + Intergenic
994057829 5:95439431-95439453 CAGAATATTCAAATAGTAAAAGG - Intronic
994828436 5:104746361-104746383 GGGAAAATACAGATGGTAAGTGG - Intergenic
995040173 5:107578581-107578603 CAGAAAAAATAAATGATAAATGG + Intronic
995296448 5:110529937-110529959 ATGTAAAAACAAATGATAAAAGG - Intronic
995550947 5:113280765-113280787 CTGAATATCCAACAGGTAAAAGG - Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
996522757 5:124445589-124445611 CTCAAAATACAAGTGCTGAATGG - Intergenic
996601025 5:125264140-125264162 CTGAAAATACAAAAAGTAGCCGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996783619 5:127215059-127215081 CTGAAAATACAAAAATTAGATGG + Intergenic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
997300315 5:132798900-132798922 CTAAAAATACAAAGGATAATAGG - Intronic
998065641 5:139155992-139156014 CTGAAAATACAAAAGTTAGCCGG - Intronic
998119913 5:139567693-139567715 CTGAAAATACAAAAAGTAGCTGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999766630 5:154745955-154745977 CTAAAAATACAAAAGTTAACTGG - Intronic
999812401 5:155140134-155140156 CTGAAAATACAAAAGTTAGGTGG + Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000067866 5:157712012-157712034 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1000326989 5:160179695-160179717 CTAAAAATACAAATATTAGACGG + Intergenic
1000432724 5:161169089-161169111 CTGAAAATACAAAAAGTAGCTGG - Intergenic
1000571825 5:162924274-162924296 TTGAAAATACAAATGCCAATTGG + Intergenic
1000749105 5:165072910-165072932 CTAAAAATACAAAAGTTAACGGG - Intergenic
1001693516 5:173651285-173651307 CAAAAAATACAAAAGATAAATGG - Intergenic
1001803440 5:174563318-174563340 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1002498649 5:179633151-179633173 CTGAAAATACAAAAATTAACTGG - Intronic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002613780 5:180437711-180437733 CTAACAATACAAATGGAAAGTGG - Intergenic
1002781310 6:368781-368803 CTAAAAATACAAATGTTAGGTGG - Intergenic
1003029160 6:2586527-2586549 CAAAAAATACAAAAGATAAATGG - Intergenic
1003478466 6:6507669-6507691 GTGAAAACACAAAAGGAAAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003943763 6:11054370-11054392 CTAAAAATACAAAAATTAAATGG + Intergenic
1003993385 6:11511592-11511614 CTAAAAATACAAATGTTAGCTGG - Intergenic
1004082637 6:12410074-12410096 CAGAAAATAAAAAAAGTAAAAGG + Intergenic
1004214128 6:13685764-13685786 CTGAAAATACAAAAAGTAGCTGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004565807 6:16796406-16796428 CTGAAAGTACAATTCATAAAAGG + Intergenic
1004609983 6:17230777-17230799 CTGAAAATACAAAAACTAACTGG + Intergenic
1004618028 6:17309059-17309081 CTGAAAATACAAAAAGTAGTGGG + Intergenic
1005227689 6:23661512-23661534 CTAAAAATACAAAAAGTTAATGG - Intergenic
1005480707 6:26252730-26252752 CAGAGAATATAAATAGTAAAGGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005630981 6:27707875-27707897 CTAAAAATACAAAAGTTAACTGG - Intergenic
1005735226 6:28739539-28739561 CTAAAAATACAAAAATTAAACGG - Intergenic
1005914904 6:30343395-30343417 CTGAAAAGGGAAATGGCAAAGGG - Exonic
1006701114 6:35974154-35974176 CTAAAAATACAAATGTTAGCTGG + Intronic
1006781165 6:36633303-36633325 CTGAAAATACAAAAATTAATTGG - Intergenic
1006819613 6:36881832-36881854 CTGAGAAAAAAAATAGTAAAGGG + Intronic
1007447791 6:41920611-41920633 CTAAAAATACAAAAAGTAACCGG + Intronic
1007448223 6:41923456-41923478 CTGAAAATACAAAAATTAACTGG - Intronic
1007547712 6:42707059-42707081 CTGAAAATACAAAAGTTAGCTGG - Intronic
1008033871 6:46725871-46725893 CTGAAAAATCAACTTGTAAAAGG + Intronic
1008105413 6:47435771-47435793 CTGAAAATACAAAAATTAGATGG + Intergenic
1008285122 6:49640170-49640192 CTGAAAATACAAATATTAGCTGG - Intergenic
1008786791 6:55177589-55177611 ATGAAAGTACAAATGGTGACTGG - Intronic
1008864565 6:56193914-56193936 CTAAAAATACAAAAGTTAACTGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009190478 6:60623356-60623378 CTGAAAATACAAAAATTAATGGG + Intergenic
1009342342 6:62571747-62571769 CTGAAAATACAAAAATTAACTGG - Intergenic
1009759971 6:67992856-67992878 CTAAAAATACAAATAGTAGCTGG + Intergenic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010164541 6:72899997-72900019 CTAAAAATACAAAAGGTAGCAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011469211 6:87690809-87690831 CTAAAAATACAAAAGTTAAACGG + Intronic
1011991767 6:93529338-93529360 CTGAAAAGCCAAATGGAAAGAGG - Intergenic
1012460582 6:99455969-99455991 CTGAAAATACAAAAATTAACCGG + Intronic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012879911 6:104774544-104774566 CTGAAAATACAAAAATTAACTGG - Intronic
1012884452 6:104829817-104829839 CTGAGAATACAATTGTTCAAAGG + Intronic
1013128472 6:107208456-107208478 CTGAAAATACAAAAAGTAGCTGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1014431294 6:121373873-121373895 CTAAAAATACAAAAAGTAACTGG + Intergenic
1014442141 6:121486432-121486454 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1014568700 6:122982820-122982842 CTGAAAAAATAAATGCTAAAGGG + Intergenic
1014568790 6:122983838-122983860 CTGAAAAAATAAATACTAAAGGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014832270 6:126116656-126116678 CTGAAAAAGCAAATCCTAAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1014909702 6:127076795-127076817 CTGAAAATACAAAGTGCATAGGG - Intergenic
1014934680 6:127373949-127373971 CTGAAAATACAAAAATTAACTGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015194996 6:130515946-130515968 CTGAAAATACAAAAAGTAGCTGG + Intergenic
1015516706 6:134089579-134089601 CTAAAAATACAAATAATAGATGG + Intergenic
1015781501 6:136871720-136871742 CTAAAAATACAAAAGTTAGATGG - Intronic
1016141336 6:140614777-140614799 CTCAAAAGACAATTTGTAAAAGG + Intergenic
1016347291 6:143127847-143127869 CTAAAAATACAAAAGGTAGCTGG - Intronic
1016698001 6:147020532-147020554 CTAAAAATACAAAAAGTAACTGG + Intergenic
1016945347 6:149527194-149527216 CTAAAAATACAAAAATTAAACGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017105682 6:150885355-150885377 CTAAAAATACAAAAGGTAGCTGG - Intronic
1017154200 6:151308372-151308394 CTGAAAATACAAAAGTTAGCTGG - Intronic
1017298625 6:152830494-152830516 CTGAAATAAAAAATGATAAATGG - Intergenic
1017401420 6:154068864-154068886 CAAAAAATACAAAAGGTAAGTGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018164543 6:161080858-161080880 CTTAAAACACAAAAAGTAAAGGG - Intronic
1018294183 6:162328195-162328217 CTAAAAATACAAAAAGTTAATGG + Intronic
1019678894 7:2333396-2333418 CTAAAAATACAAATAGTAGCTGG + Intronic
1020083806 7:5299888-5299910 CTGAAAATACAAAAATTAAATGG + Intronic
1020113862 7:5464180-5464202 CTAAAAATACAAATATTAACTGG + Intronic
1020188778 7:5978430-5978452 CTGAAAATACAAAAAGTAGCCGG - Intronic
1020195254 7:6033128-6033150 CTAAAAATACAAATGTTAGCTGG - Intronic
1020265373 7:6556816-6556838 CTGAAAATACAAAAGTTAGCCGG + Intergenic
1020294136 7:6746332-6746354 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1020338216 7:7081375-7081397 CTAAAAATACAAAAAGTAACTGG - Intergenic
1020524479 7:9241197-9241219 CTAAAAATATAAAAAGTAAATGG - Intergenic
1020564180 7:9775205-9775227 CTAAAAATATATATAGTAAAGGG + Intergenic
1020625371 7:10571678-10571700 ATGAAAATATTATTGGTAAAGGG - Intergenic
1020902259 7:14019670-14019692 CTGAAAAAAGAATAGGTAAAGGG - Intergenic
1021025054 7:15656389-15656411 ATGAAAAAACAAAAAGTAAAAGG - Intronic
1021108902 7:16671767-16671789 CTGAAAATACAAAAGCTAGCTGG + Intronic
1021113728 7:16725081-16725103 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1021544797 7:21800992-21801014 CCTAAAATACGTATGGTAAAGGG + Intronic
1022827620 7:34032252-34032274 CTGGAAGTACATATGGTTAAGGG - Intronic
1023424400 7:40020227-40020249 CTGAAAATACAAAAAGTAGCTGG - Intronic
1023674300 7:42614502-42614524 CTGAAAATAGCAGAGGTAAAAGG - Intergenic
1023796159 7:43794079-43794101 CTGAAAATACAAAAATTAACTGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024371653 7:48591235-48591257 CTGAAATTAAAACTGGGAAAAGG - Intronic
1025096207 7:56097273-56097295 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1025210469 7:57017297-57017319 CTGAAAATACAAAAATTAAATGG - Intergenic
1026064812 7:67061064-67061086 CTAAAAATACAAAAGTTAGATGG + Intronic
1026340085 7:69427505-69427527 CTGAAAATACAAAAGTTAGTTGG - Intergenic
1026669340 7:72374365-72374387 CTAAAAATACAAAAGTTAACCGG + Intronic
1026713486 7:72765625-72765647 CTAAAAATACAAAAGTTAGATGG - Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027203793 7:76080998-76081020 CTGAAAATACAAAAGTTAGCCGG - Intergenic
1027257669 7:76441548-76441570 CTGAAAATAAAAAAGTTAACTGG - Intronic
1027281179 7:76610488-76610510 CTGAAAATAAAAAAGTTAACTGG + Intronic
1027345150 7:77251985-77252007 CTGAAAATACAAATATTAGCTGG + Intronic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1027537268 7:79419341-79419363 CTTAAAATAGTATTGGTAAATGG - Intronic
1027803780 7:82789542-82789564 CTAAAAATACAAAAGTTAACTGG + Intronic
1027980384 7:85212137-85212159 CTAATAGTACAAATGGTATAGGG + Intergenic
1028069956 7:86439663-86439685 CTAAAAATTCAAATGCTAGAAGG + Intergenic
1028214128 7:88110902-88110924 CTGAAAATACAAAAATTAGATGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028685110 7:93583146-93583168 CTAAAAATACAAAAAGTAACTGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029013260 7:97285405-97285427 CTGATAATACAAATAGAATATGG + Intergenic
1029019685 7:97351360-97351382 CTAAAAATACAAACAGTAGATGG + Intergenic
1029121675 7:98272321-98272343 CTAAAAATACAAATCTTAACTGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029239198 7:99146548-99146570 CTAAAAATACAAAAGTTAACTGG + Intergenic
1029400657 7:100343561-100343583 CTAAAAATACAAAAGGTAGCTGG - Intronic
1029730656 7:102435794-102435816 CTAAAAATACAAAAAGTAACTGG - Intronic
1029862908 7:103593968-103593990 CTAGAAATGCAAATGGTACATGG - Intronic
1030216862 7:107052752-107052774 CAGAGAATGCAAATTGTAAAAGG - Intronic
1030735649 7:113044994-113045016 GAGAAAATACAAATAATAAATGG + Intergenic
1030865282 7:114695167-114695189 CTGAACATACGGAGGGTAAAGGG - Intergenic
1031276322 7:119727991-119728013 CTCAAAATTTAAAGGGTAAATGG - Intergenic
1031305270 7:120118173-120118195 CTGAGAAAAAAAATTGTAAAGGG + Intergenic
1031341995 7:120614172-120614194 CTGAAAATACAAAAAGTAGCTGG - Intronic
1032116037 7:129118082-129118104 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1032172241 7:129594598-129594620 CAAAAAATACAATTTGTAAAGGG - Intergenic
1032381792 7:131492196-131492218 AAGAAAAGACAAAAGGTAAATGG - Exonic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032398697 7:131608798-131608820 CTGAAAATACAAAAATTAACTGG + Intergenic
1032621831 7:133542111-133542133 CTGAAAATTCAACTGGCAAAAGG + Intronic
1032722659 7:134563384-134563406 CTAAAAATACAAAAGTTAGATGG + Intronic
1032995930 7:137446562-137446584 CTGAAAATACAAAAAGTAGCTGG + Intronic
1033401330 7:141027688-141027710 CTAAAAATACAAAAGTTAACTGG - Intergenic
1033690635 7:143733173-143733195 CTGAAAATACAAAAATTAACTGG + Intergenic
1033914727 7:146309638-146309660 CTGAAAATACAAAAATTAATCGG + Intronic
1034025644 7:147700499-147700521 CTGAGAATAAAAGTGGCAAATGG - Intronic
1034556279 7:151852331-151852353 CTGAAAATACAAAAATTAACCGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034844848 7:154434996-154435018 CTAAAAATACAAAAAGTAATGGG - Intronic
1035091442 7:156316221-156316243 CTAAAAATACAAATATTAATGGG - Intergenic
1035182181 7:157097459-157097481 CTGAAAATACAAACACTAACTGG + Intergenic
1035841061 8:2812206-2812228 CTGAAAATACAAAAAGTAGCCGG + Intergenic
1036512368 8:9412600-9412622 CTCCAAATACTAATGGGAAATGG + Intergenic
1036582800 8:10091431-10091453 AGGAAAATATATATGGTAAACGG - Intronic
1036693089 8:10957110-10957132 CTAAAAATACAAAAATTAAACGG - Intronic
1036990671 8:13589789-13589811 TTTAAAATATAAATGGTGAAAGG + Intergenic
1037328456 8:17719006-17719028 CTGAAAATACAAATATTAGCTGG + Intronic
1037512441 8:19597681-19597703 GAGAAAATACAGATGTTAAAAGG + Intronic
1038379403 8:27078669-27078691 AGGAAAAAACAAATGGGAAAGGG + Intergenic
1038456587 8:27675626-27675648 CTGAAAATACAAAAATTAACTGG + Intronic
1038487477 8:27947171-27947193 CTAAAAATACAAAAGGTAGCCGG - Intronic
1038556265 8:28520046-28520068 CTGAAAATACAAATATTATCTGG + Intronic
1038758812 8:30367387-30367409 CTGAAAATACAAAAATTAGATGG + Intergenic
1038846151 8:31231212-31231234 ATGAAAATAAAAAAGGTCAAAGG - Intergenic
1038976483 8:32702647-32702669 CTAAAAATACAAAAGTTAACCGG - Intronic
1039253128 8:35688397-35688419 CTGAAAATACAACAGGTAGCAGG - Intronic
1039515822 8:38132635-38132657 CTAAAAATACAAAAAGTAACCGG + Intronic
1039568630 8:38568615-38568637 CTGAAAATCCAACTCATAAAAGG + Intergenic
1039682128 8:39751992-39752014 CTGAAAATACAAAAATTAAGTGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039830504 8:41209985-41210007 TTGAAAATACATATGGTAGGGGG - Intergenic
1040440944 8:47441566-47441588 GTAAAAAGTCAAATGGTAAATGG - Intronic
1040788734 8:51199064-51199086 CTGAAAATACAAATGGCTGGGGG - Intergenic
1040927778 8:52702552-52702574 CTGAAAATACAAAAGTTAGCTGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041297590 8:56375085-56375107 CTAAAAATACAAAAGTTAACCGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041681553 8:60598034-60598056 CTGAAAATACAAAAAGTAGCTGG + Intronic
1042038040 8:64559462-64559484 CAGAAAATAAATGTGGTAAATGG - Intergenic
1042149826 8:65769732-65769754 CTGAAAATACAAATATTAGCCGG + Intronic
1042329311 8:67561242-67561264 CTGAGAATACAAATGAGGAACGG + Intronic
1042358975 8:67860838-67860860 CTGAAAATGCTACTGGTGAATGG + Intergenic
1042454150 8:68980587-68980609 CTAAAAATAAATATGTTAAAAGG - Intergenic
1042569098 8:70143109-70143131 CTAAAAATACAAAAATTAAATGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044023891 8:87143905-87143927 CTGATAAAACAACTGTTAAAGGG + Intronic
1044094556 8:88046960-88046982 CTGAAAATACAATGGGCATAAGG + Intronic
1044195097 8:89366812-89366834 ATGAAAATTAAAGTGGTAAATGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044999319 8:97866731-97866753 CTAAAAATACAAAAGGTAGCCGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045882054 8:107052518-107052540 TTCAAAATACAAAGGGAAAAAGG + Intergenic
1046035775 8:108839696-108839718 CTGAAAAAAGAAATAGGAAAAGG + Intergenic
1046531611 8:115453180-115453202 CTAAAAATACAAAAGGTAGCTGG - Intronic
1046771985 8:118125541-118125563 CTGAAAATACAAAAATTAACTGG + Intergenic
1046955942 8:120063030-120063052 CTGAAAATACAAAAAGTAGTTGG - Intronic
1046972165 8:120235162-120235184 CAAAAAATAAAAATGATAAAGGG - Intronic
1047236415 8:123045918-123045940 CTGAAAATACAAAAATTAACCGG + Intronic
1047661367 8:127040519-127040541 CTGAAAATACCAAGAATAAATGG + Intergenic
1047738860 8:127790878-127790900 CTGAAAATACAAAAAGTAGCTGG + Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048104899 8:131397249-131397271 CTGAAAATACAAAAGTTATCTGG + Intergenic
1048241968 8:132751528-132751550 GTGGAAATACAAAGGGTAAGAGG - Intronic
1048241984 8:132751647-132751669 GTGGAAATACAAAGGGTAAGAGG - Intronic
1049333949 8:142072087-142072109 CTGAAAATACAAAAATTAACTGG + Intergenic
1049739058 8:144226612-144226634 CTGAAAATACAAAACTTAGACGG - Intronic
1049823669 8:144653374-144653396 CAGAAACTACAAACAGTAAAAGG + Intergenic
1049918858 9:344888-344910 CTAAAAATACAAAAAGTAACTGG + Intronic
1050212232 9:3273700-3273722 CTGAAAATACAAAAAGTTAGTGG + Intronic
1050278784 9:4028732-4028754 CTGCACATACAAGTGGCAAATGG + Intronic
1050889882 9:10810979-10811001 ATGAACATACAAATGTTACATGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051290317 9:15538804-15538826 CTAAAAATACAAATGTTAGCTGG - Intergenic
1051302666 9:15669596-15669618 TTGAAAATTCAGATGGTTAATGG - Intronic
1051625339 9:19093705-19093727 CTGAAAATACAAAAGTTATCTGG + Intronic
1051835044 9:21326349-21326371 CTAAAAATAAAAATGGTATGGGG + Intergenic
1051937879 9:22466449-22466471 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1051966213 9:22832804-22832826 CTGAAAATACAAAAATTAACTGG + Intergenic
1052003576 9:23318578-23318600 TTAAAAATACAAAAGGTAGATGG + Intergenic
1052007535 9:23367025-23367047 CTAAAAATATAAATGTTAATTGG - Intergenic
1052051027 9:23850134-23850156 CTAACAAAACAAAAGGTAAAGGG + Intergenic
1052130946 9:24846047-24846069 CTGAAAGTACAAAAGTTAATCGG + Intergenic
1052158769 9:25228975-25228997 CTAAAAAAAGAAATGTTAAAGGG - Intergenic
1052293034 9:26866006-26866028 CTGAAAATACAAAAATTAACCGG - Intronic
1052432276 9:28381877-28381899 CTGAAGAAACAAAATGTAAATGG - Intronic
1052737316 9:32355509-32355531 CTAAAAATACAAAAATTAAACGG + Intergenic
1052821644 9:33142142-33142164 CTGAAAATACAAAAATTAACTGG - Intronic
1053070295 9:35097146-35097168 CTGAAAATACAAAAGTTACCCGG + Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053402218 9:37835415-37835437 CTGAAAATACAAAAATTAACCGG + Intronic
1053403619 9:37851080-37851102 CTGAAAATACAAAGAGTAGCCGG + Intronic
1053442884 9:38130379-38130401 CTGAAAATACAAACAGTAGTTGG + Intergenic
1053465386 9:38303547-38303569 CTAAAAATACAAAAAGTAACTGG + Intergenic
1053622528 9:39834717-39834739 GTGAAAATGCAAATTATAAAAGG + Intergenic
1053711291 9:40812023-40812045 CTAAAAATACAAAAATTAAATGG + Intergenic
1053882333 9:42608363-42608385 GTGAAAATGCAAATTATAAAAGG - Intergenic
1053890336 9:42685930-42685952 GTGAAAATGCAAATTATAAAAGG + Intergenic
1053935828 9:43150263-43150285 CTAAAAATACAAAAATTAAACGG + Intergenic
1054221358 9:62415831-62415853 GTGAAAATGCAAATTATAAAAGG - Intergenic
1054229356 9:62493342-62493364 GTGAAAATGCAAATTATAAAAGG + Intergenic
1054277856 9:63102997-63103019 CTAAAAATACAAAAATTAAACGG - Intergenic
1054298961 9:63357428-63357450 CTAAAAATACAAAAATTAAACGG + Intergenic
1054396981 9:64661930-64661952 CTAAAAATACAAAAATTAAACGG + Intergenic
1054421201 9:64932840-64932862 CTAAAAATACAAAAATTAAATGG + Intergenic
1054431623 9:65167134-65167156 CTAAAAATACAAAAATTAAACGG + Intergenic
1054498755 9:65854385-65854407 CTAAAAATACAAAAATTAAACGG - Intergenic
1054740335 9:68800147-68800169 CTGAAAATAGTGATGGTGAAGGG + Intronic
1054742488 9:68821996-68822018 ATGAAAATACACATAATAAAAGG + Intronic
1054955838 9:70908970-70908992 CTGTAGATATAAATGGGAAATGG + Intronic
1055104608 9:72499576-72499598 CTAAAAATACAAAAATTAAATGG + Intergenic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1055235539 9:74118248-74118270 CTGAAAAGACAAATGGCACTAGG - Intergenic
1055242435 9:74199726-74199748 CTGACACTACATATTGTAAAAGG - Intergenic
1055288495 9:74757014-74757036 CTGAAAATACAAAAGTTAGCTGG + Intronic
1055427226 9:76208538-76208560 CTGAAACTATAAATCATAAAAGG - Intronic
1056281719 9:85048003-85048025 CTGAAAAAAAAAAAGGTATAGGG - Intergenic
1056412161 9:86340352-86340374 CAGAAAATTCAAATGTTATATGG + Intronic
1056541782 9:87577634-87577656 CTAAAAATACAAAAGTTAACTGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056799162 9:89679614-89679636 GTCAAAATACAAATGTTAAAAGG + Intergenic
1056856824 9:90138714-90138736 TTGTAAATAGAAATGGTCAAGGG + Intergenic
1057564157 9:96153517-96153539 CTAAAAATACAAAAAGTAACAGG - Intergenic
1057830123 9:98399870-98399892 TTCAAAATAAAAATGGTCAAAGG + Intronic
1058352831 9:104046646-104046668 GTGAAGAGACAACTGGTAAATGG + Intergenic
1058463058 9:105201059-105201081 CTGAAAATACAAAAATTAACCGG - Intergenic
1058501113 9:105618232-105618254 CAGAAATTACAAGTGGTAACAGG - Intronic
1058891744 9:109367025-109367047 CAGGACATACAACTGGTAAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059293886 9:113252455-113252477 CTGAAAATACAAAAAGTACCCGG - Intronic
1059531415 9:115038987-115039009 CTGAAAATACAAAAGTTAGCTGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060359652 9:122942506-122942528 CTGAAAATACAAAAATTAGACGG + Intronic
1061349897 9:130055780-130055802 CTAAAAATACAAATATTAGACGG + Intronic
1061791687 9:133062430-133062452 CTAAAAATACAAATATTAATCGG + Intronic
1061795361 9:133082988-133083010 CTAAAAATACAAATATTAATCGG + Intronic
1062643141 9:137532273-137532295 CTAAAAATACAAATATTACACGG + Intronic
1062669857 9:137701953-137701975 CTAAAAATACAAAAATTAAATGG - Intronic
1203437752 Un_GL000195v1:157287-157309 CTGAAAATACAAAAGTTAGCCGG + Intergenic
1203687796 Un_GL000214v1:11580-11602 CTGAAAATACAAAAATTAACTGG - Intergenic
1203537001 Un_KI270743v1:49385-49407 CTGAAAATACAAAAATTAACTGG - Intergenic
1203648479 Un_KI270751v1:92473-92495 CTGAAAATACAAAAATTAACTGG + Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1185686093 X:1929747-1929769 CTGATAATACAATAGGTAAAGGG + Intergenic
1185686692 X:1934657-1934679 CTAAAAATACAAATAGTAGCTGG + Intergenic
1185768674 X:2748039-2748061 CTGAAAATACAAAAAGTAGCCGG - Intergenic
1185771513 X:2768604-2768626 CTGAAAATACAAAAGTTAGCTGG + Intronic
1185836981 X:3353747-3353769 TTCAAAATAAAAATGGCAAATGG + Intergenic
1185946456 X:4382424-4382446 CTTCAAATATAAATGGTAATTGG + Intergenic
1185992796 X:4910981-4911003 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1186026171 X:5315633-5315655 CTGAAAATACAAAAATTAACTGG + Intergenic
1186045264 X:5529738-5529760 CTGAAAATAATCATGGTAGAAGG - Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186417770 X:9398580-9398602 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1186429179 X:9489767-9489789 CTGAAAAGTCACATGGCAAAGGG + Intronic
1186734187 X:12443827-12443849 GTCAAAATATGAATGGTAAATGG - Intronic
1187311286 X:18145798-18145820 GTGAAAATAGAGATTGTAAATGG - Intergenic
1187955294 X:24511684-24511706 CTAAAAATACAAAAGTTAGACGG + Intronic
1188032903 X:25284288-25284310 CTCAAAATACAAATGTTATTTGG - Intergenic
1188191850 X:27181220-27181242 CTGAAAAATCAAATTGCAAAAGG - Intergenic
1188218199 X:27505211-27505233 ATGAAAAAACAACTGGTAAGTGG + Intergenic
1188316181 X:28676569-28676591 CTAAAAATACAAAAGTTAACTGG + Intronic
1188500964 X:30825669-30825691 CTAAAAATACAAAAGTTAACCGG + Intergenic
1188842328 X:35031365-35031387 CTGAAAATACACATACTTAAAGG + Intergenic
1188906435 X:35797858-35797880 CTAAAAATACAAAAGTTAGACGG + Intergenic
1189190810 X:39102322-39102344 CTGAAAATACAAAAAATTAACGG - Intergenic
1189258274 X:39657499-39657521 CTGTGAATACAAATGGGAACAGG + Intergenic
1189499624 X:41544402-41544424 CTGAAAATACAAAAAGTAGCTGG + Intronic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189708579 X:43784984-43785006 CTAAAAATACAAATATTAGATGG + Intronic
1189810240 X:44774686-44774708 CTAAAAATACAAAAGTTAATCGG - Intergenic
1190020684 X:46871181-46871203 CTGAAAATACAAATATTAGCCGG - Intronic
1190047813 X:47126807-47126829 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1190235582 X:48612815-48612837 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1190312225 X:49124658-49124680 CTGAAAATACAAAAATTAGAGGG + Intergenic
1191048663 X:56167290-56167312 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1192107933 X:68334057-68334079 CTAAAAATACAAAAATTAAATGG - Intronic
1192357439 X:70417483-70417505 CTGAAAATACAAAAAGTAGCCGG + Intronic
1192423078 X:71051281-71051303 ATGAAAATACAAATACTATATGG + Intergenic
1192747742 X:73956530-73956552 CTAAAAATACAAAAATTAAACGG - Intergenic
1192805026 X:74501192-74501214 ATGGTAATATAAATGGTAAATGG + Intronic
1193751007 X:85343478-85343500 ATGACAATAGAAATGGTAGAAGG - Intronic
1193897751 X:87134252-87134274 CTAAAAATACAAAAGTTAACTGG + Intergenic
1193901940 X:87190890-87190912 CAGAAAACACAAAAGGTTAAGGG - Intergenic
1194015244 X:88611059-88611081 CTGAAAATACAAAAATTAACTGG + Intergenic
1194574240 X:95592396-95592418 CTGAAAAATCAACTGGCAAAAGG + Intergenic
1194900413 X:99502789-99502811 CTGAAAATACAAAAATTAACCGG - Intergenic
1194935966 X:99949383-99949405 CTGAAAATACAAAAGTTAGCTGG - Intergenic
1195057306 X:101158790-101158812 CTAAAAATACAAATATTAGATGG - Intronic
1195754927 X:108191087-108191109 CTGAAAAAACAAAGGCTTAAGGG + Intronic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196145939 X:112316931-112316953 CTGTAAATACAAAATGCAAAGGG + Intergenic
1196681589 X:118475194-118475216 CTGAAAATACAAAATGTAGATGG + Intergenic
1196784382 X:119409340-119409362 CTAAAAATACAAAAAGTAACTGG - Intronic
1196784435 X:119409775-119409797 CTAAAAATACAAAAAGTAACTGG - Intronic
1197833145 X:130666706-130666728 TTCAAAATACAAGTGGCAAATGG + Intronic
1197859379 X:130953322-130953344 CTAAAAATACAATTTATAAAAGG - Intergenic
1197994115 X:132353927-132353949 CTAAAAATTCAAAAGGTAGATGG - Intergenic
1198472716 X:136963833-136963855 CTGAAAATACAAAAGTTAGTTGG - Intergenic
1198764484 X:140066746-140066768 CTGAAAATACAAAAATTAACCGG - Intergenic
1198920425 X:141719726-141719748 CTGAAAATACAAAAGTTAGCTGG + Intergenic
1199096219 X:143743667-143743689 CTAAAAATACAAAAAGTAACTGG + Intergenic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1199658886 X:150026435-150026457 TAGAAAATATAAATAGTAAATGG - Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200381801 X:155844883-155844905 CAGAAAATACAAAAGTTAACTGG - Intergenic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1200747208 Y:6912667-6912689 CTGAAAATACAAAAGTTAGCAGG + Intronic
1200873943 Y:8133351-8133373 CTGAAAATACAAAAATTAACTGG - Intergenic
1201168450 Y:11233789-11233811 CTGAAAATACAAAAGTTAACTGG + Intergenic
1201239583 Y:11945989-11946011 TTCAAAATAAAAATGGCAAATGG - Intergenic
1201251731 Y:12065452-12065474 CTGAAAATACAAAAATTAGATGG - Intergenic
1201301700 Y:12510942-12510964 CTGAAAATACAAAATGTAGCCGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201733672 Y:17233820-17233842 CTTCAAATACAAATGGTAATTGG + Intergenic
1201789151 Y:17818759-17818781 CTGAAAATACAAAAGTTACCTGG - Intergenic
1201812402 Y:18087228-18087250 CTGAAAATACAAAAGTTACCTGG + Intergenic
1201901916 Y:19052158-19052180 CTGAAAATACAAAAATTAACTGG + Intergenic