ID: 1018017589

View in Genome Browser
Species Human (GRCh38)
Location 6:159726691-159726713
Sequence CGCTGTGTCCGCGGCGTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018017589 Original CRISPR CGCTGTGTCCGCGGCGTTGA GGG (reversed) Exonic
901251976 1:7785565-7785587 CGCTGTGTCCACAGCGTTCAAGG + Exonic
904082292 1:27879841-27879863 CGCTGTGTCCTGGGCATGGAGGG + Exonic
915499005 1:156301629-156301651 GGCTGGGTCCGGGGCTTTGATGG - Intergenic
915511209 1:156388047-156388069 CGCGGGGCCAGCGGCGTTGAGGG + Intergenic
916572074 1:166036776-166036798 TTCTGTGTCTGCTGCGTTGAGGG - Intergenic
1079241618 11:18726108-18726130 TGCTGTGTCCACGGCTTTGGAGG + Exonic
1124469171 15:29968413-29968435 CGCTGTGCCCGCGGCGCGTAGGG - Intronic
1140724882 16:77802933-77802955 TGCTGTGTCCGCTGCCGTGATGG - Intronic
1152871024 17:82752916-82752938 CGCTCTGTCCACGGCGTCCACGG - Intronic
1169532846 20:6504015-6504037 TGCTGTCTCCGCGACGTTGGGGG + Intergenic
968161733 3:196432357-196432379 CGCGGCGTCCTCGGCGCTGAAGG - Exonic
969577688 4:8046184-8046206 CGCTGTGTCCCCTGGGCTGATGG + Intronic
972104383 4:35463426-35463448 CTCGGTGTCCGCGTCGTCGATGG - Intergenic
979122897 4:116926171-116926193 AGCTGTGTCCGCGGGGATGTGGG - Intergenic
980730930 4:136823786-136823808 GGCTGTGTCCGGGGCTTTCATGG + Intergenic
995512484 5:112922413-112922435 CGCAGCGTCCGCGGAGTTGCAGG - Exonic
996978425 5:129461209-129461231 GGCTGGGTGCGCGGCGTTGGGGG + Exonic
1005905745 6:30260456-30260478 CGCTGTGTTCGCGGCGGTCCAGG - Intergenic
1006043079 6:31271203-31271225 CGCGGTGTCCGCGGCGGTCCAGG + Exonic
1006052671 6:31356297-31356319 CGCCGTGTCCGCGGCGGTCCAGG + Exonic
1018017589 6:159726691-159726713 CGCTGTGTCCGCGGCGTTGAGGG - Exonic
1027672528 7:81119158-81119180 GGCTGAGTCCGGGGCTTTGATGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1185525353 X:774178-774200 CGGTGTGTGTGCTGCGTTGAAGG + Intergenic