ID: 1018017651

View in Genome Browser
Species Human (GRCh38)
Location 6:159727057-159727079
Sequence GCCCCAGGGCATCACGGGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018017651_1018017661 13 Left 1018017651 6:159727057-159727079 CCCTTCCCGTGATGCCCTGGGGC 0: 1
1: 0
2: 2
3: 20
4: 152
Right 1018017661 6:159727093-159727115 CGCTGGCCCGCCCCTCCCCTCGG 0: 1
1: 1
2: 3
3: 40
4: 370
1018017651_1018017657 -4 Left 1018017651 6:159727057-159727079 CCCTTCCCGTGATGCCCTGGGGC 0: 1
1: 0
2: 2
3: 20
4: 152
Right 1018017657 6:159727076-159727098 GGGCTGACCTCCGACCTCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018017651 Original CRISPR GCCCCAGGGCATCACGGGAA GGG (reversed) Exonic
900094979 1:936586-936608 GCCCCAGGGCAGGCCGTGAAAGG + Intronic
900428772 1:2592403-2592425 GCGCCAGTGCATCAGGGGAGGGG - Intronic
901155846 1:7137701-7137723 GCCTCAGGATATCAGGGGAAAGG - Intronic
901490916 1:9595796-9595818 GCCCCAGGGCCACCAGGGAAAGG - Intronic
902103921 1:14017538-14017560 GCCCAAGGGCATCACGTAAGAGG + Intergenic
902918123 1:19650997-19651019 CCCCCAGGGGATCATGGGAAAGG - Intronic
903304216 1:22401296-22401318 GCATCAGGGCATCATGGGCATGG - Intergenic
903356388 1:22750462-22750484 GCTCCAGGGGAACACGGAAATGG + Intronic
903943308 1:26946308-26946330 GTCCCGGGGCATCAGGAGAAAGG + Exonic
904383647 1:30127775-30127797 GACCCAGTGCATTACAGGAATGG - Intergenic
905136926 1:35807628-35807650 GCCGGAAGGCACCACGGGAATGG - Intergenic
906190160 1:43893693-43893715 GACCCAGAGCTTCAGGGGAAGGG - Intronic
906693267 1:47806942-47806964 GCCCAAGGGAATCACTGCAAAGG + Intronic
907844464 1:58191130-58191152 GACTCAGGTCATCACAGGAAGGG + Intronic
912542310 1:110426153-110426175 GCCCCAGGGAACCAAGGAAACGG - Intergenic
913028011 1:114865510-114865532 GACCCAGGGCAGCACAGCAAAGG - Intronic
915039115 1:152952946-152952968 GTGCCAGGGCATGACAGGAAGGG + Intergenic
917003744 1:170388646-170388668 GCCTGAGGGCAGCAGGGGAAGGG + Intergenic
917259391 1:173150424-173150446 GCCCCTGGTCATCACGGGAAAGG + Intergenic
918070155 1:181128681-181128703 GCCCCAGGGCAGGCCGGGCAGGG + Intergenic
920099104 1:203505790-203505812 GCCCCAGGGAAGGACGGGGAAGG + Intronic
920276197 1:204806934-204806956 GCTCCAGGACACCACTGGAAGGG + Intergenic
921128953 1:212202799-212202821 GGCCCAGGGCATGCTGGGAAGGG + Intergenic
1062810227 10:457934-457956 GCCCCAGAGCAGCACGTGATGGG + Intronic
1069630276 10:69893435-69893457 TCCCAAGAGCATCACTGGAAGGG - Intronic
1069874508 10:71553384-71553406 GCCCCAGGGCACCAAGTGACAGG + Intronic
1070592885 10:77812906-77812928 GCCCCAGGGCAGCAAGTGCATGG - Intronic
1072975556 10:100054422-100054444 TCACCAGGGCATCAAGGGAATGG - Exonic
1073115584 10:101089818-101089840 GCCCCATGGCCTCTTGGGAAAGG + Exonic
1073287454 10:102397392-102397414 GCCCCAGGGCCTTACGGGTATGG + Exonic
1073987040 10:109221495-109221517 TCCCCAGGGAATCAAGAGAAAGG - Intergenic
1074188316 10:111115441-111115463 GCTCCAGGGCAGCTCGGGCAGGG - Intergenic
1075733496 10:124650278-124650300 GGCCCAGGTCATCGCGGGACAGG + Intronic
1076662409 10:132064466-132064488 GCTTCAGGGCAACACGGGAGGGG + Intergenic
1076728387 10:132424392-132424414 TCCCCAGGGCATCTCTGGATGGG + Intergenic
1076858776 10:133129894-133129916 GCAGCAGGGCATCTCGGGCAGGG - Exonic
1081837296 11:46166391-46166413 ACCCCAGGGCAGGAAGGGAAAGG + Intergenic
1082143239 11:48634437-48634459 GCCTCAGGGCTTCTTGGGAATGG + Intergenic
1082571046 11:54740917-54740939 GCCTCAGGGCTTCTTGGGAATGG + Intergenic
1082612197 11:55313896-55313918 GCCTCAGGGCTTCTTGGGAATGG + Intergenic
1082795931 11:57377757-57377779 TCCCCAGGGCAACCTGGGAATGG - Exonic
1083253849 11:61484723-61484745 GCCTCAGGCCATCACGGGGCTGG + Exonic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1087132226 11:94678242-94678264 GGCCCAGGGCATCACGATAGAGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089158478 11:116420313-116420335 TCCCCAGGGCCTCCAGGGAAGGG - Intergenic
1090177253 11:124662047-124662069 GCCCCAAGACATCAGAGGAAGGG + Intronic
1092391341 12:8082632-8082654 GCCCCAGGGGATTACGGGAGAGG - Intronic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1096096310 12:48937963-48937985 GACCCAGGGCATTGGGGGAAGGG - Exonic
1097223950 12:57465930-57465952 GCCCCAGGGGGTAACAGGAATGG + Intronic
1097648081 12:62260346-62260368 GCCCCAGAGCATTATGGGAATGG - Exonic
1102140891 12:110614095-110614117 GGCGCGGGGCATCACGGGAAGGG - Intronic
1105929817 13:25041819-25041841 GCACCAGGGAATCACTGGAAAGG - Intergenic
1113880413 13:113622393-113622415 GCGTCAGGGCAACACTGGAAGGG - Intronic
1118382642 14:65229893-65229915 GCCCTAGGGGTTCACGGGAGAGG + Intergenic
1120741129 14:88110168-88110190 GACACATGGCATCATGGGAATGG - Intergenic
1121612349 14:95290198-95290220 GACCCAGGGCATCATGGTAAGGG - Intronic
1122636212 14:103130894-103130916 GCCCCTGGGCATCATGGAACTGG - Intronic
1122723775 14:103737044-103737066 GCCCCAGGCCACCCCAGGAAAGG + Intronic
1123759789 15:23423355-23423377 GCCCCAGGACACCAAGGGCAGGG + Intergenic
1125323035 15:38509024-38509046 GCCACAGTGCATGATGGGAATGG - Intronic
1125490896 15:40147680-40147702 GCCCCAGGGCAGCTCCAGAAGGG + Intergenic
1129862387 15:78872774-78872796 GCCCCAGGGCACGCCGGGACTGG - Intronic
1130992942 15:88887333-88887355 GCCCCAGGGCAAACTGGGAAGGG + Exonic
1132932255 16:2464670-2464692 GGCCGAGGGCAGCATGGGAAAGG - Exonic
1133281960 16:4671684-4671706 TCCCCAGGGCAGCCCAGGAATGG + Intronic
1134456551 16:14399540-14399562 GCCCCAGGACACCAAGGGCAGGG - Intergenic
1135761968 16:25145076-25145098 GCCCCAGGGTTTCTTGGGAATGG - Intronic
1138194614 16:55043232-55043254 ACCCCAGGGCATCACCAGAGGGG + Intergenic
1139913992 16:70417224-70417246 GCCCCATGGCATCACAAGGAAGG + Intronic
1140481332 16:75264418-75264440 GGCCCAGGGCCTCAGGGGACTGG - Exonic
1141634513 16:85306914-85306936 GCCCCAGTGCATAACAGGAAGGG - Intergenic
1141649015 16:85382680-85382702 GCCCCAGGCCATCAAGAGCATGG + Intergenic
1143378906 17:6483581-6483603 GGCCCAGGGCAGCAGGGAAATGG + Exonic
1143560035 17:7688306-7688328 GCCCTAGGGCTTGATGGGAACGG + Exonic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1143975866 17:10829182-10829204 GCCCCATGTCTTCACGGAAACGG - Intronic
1147423232 17:40332703-40332725 GCCCCAGGGCATAAAGGGCGGGG - Intronic
1149712474 17:58755965-58755987 GCCCCAGGGCAGACCGGGAAAGG - Exonic
1150009961 17:61494351-61494373 AGCCCAGGGCATGACAGGAATGG - Intergenic
1152406467 17:80101123-80101145 TCCCGAGGGCATCATCGGAAAGG - Intergenic
1152734146 17:81988787-81988809 GTCTCAGGGCATCCCGGGCAGGG + Intronic
1152770301 17:82163443-82163465 GTGCCATGGCCTCACGGGAAAGG - Intronic
1152809698 17:82375638-82375660 GCTTCTGGGCATCACGGGAAGGG - Intergenic
1153611348 18:6888756-6888778 CCCCCAGAACATCACGGGACTGG + Intronic
1154105552 18:11519484-11519506 GCCCCATGGCCACCCGGGAAGGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1156478843 18:37423581-37423603 GCCCCAGGGCAACCCAGCAATGG + Intronic
1157887471 18:51383024-51383046 GCCCCAGGGCAGGAAGGGAGAGG - Intergenic
1161042039 19:2115454-2115476 ACCCCAGGGGCTCACGGGGAGGG + Intronic
1162101688 19:8342914-8342936 TCCCCAGGCCGTCCCGGGAAAGG + Intronic
1163827992 19:19534626-19534648 GCCCCAGGGCATCGTGGCTAAGG + Intronic
1165076074 19:33280767-33280789 GGCCATGGGCATCAGGGGAAGGG - Intergenic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
1167320781 19:48796161-48796183 GCCGCAGAGGATCACAGGAAGGG + Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
1167666208 19:50823875-50823897 GCCCCCAGGCAACAGGGGAAGGG - Intergenic
925365567 2:3309629-3309651 AACCCAGAGCATCCCGGGAAAGG + Intronic
927235630 2:20871944-20871966 GTCCCAGGGCATGACAGGCAGGG - Intergenic
929175213 2:38968964-38968986 GCCCCAGTGTAGCACAGGAAGGG + Intronic
929963123 2:46511320-46511342 GCCTCAGGGCACCAGGGGACTGG + Intronic
932605512 2:73163082-73163104 GCCCCACGGGGTCAGGGGAAGGG + Intergenic
934546447 2:95220598-95220620 GCACCAGGATGTCACGGGAAAGG - Intronic
935361076 2:102246712-102246734 GCCCAAGGGCATCAAGTGGATGG + Intergenic
940322408 2:152390762-152390784 ATCCCAGGGCATCAGGAGAAAGG + Intronic
940567507 2:155386515-155386537 ACTCCAGGGGATCACAGGAATGG - Intergenic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
947392226 2:229651118-229651140 TCCCAAGGGCATCCCAGGAAAGG + Intronic
1174037868 20:47679142-47679164 GCCCCAGAGGTTCAGGGGAAGGG - Intronic
1176000335 20:62828757-62828779 TCCCCAGGGCATGCCGGGCAAGG + Exonic
1176849113 21:13899211-13899233 GCCCCAGGGCCTGACAGCAAGGG + Intergenic
1177009641 21:15716443-15716465 GACCCAGGGCATCACAAAAAGGG - Intergenic
1180014006 21:45071260-45071282 GGCCCTGGGCATGACAGGAAGGG + Intergenic
1184741159 22:46429824-46429846 GTCCTAGAGCATCAAGGGAAAGG - Intronic
1185417789 22:50719837-50719859 GGCCCAGGGCTGCACGGGGAGGG - Intergenic
950055632 3:10022055-10022077 GCCCCAGGGCGCCACTGGAGCGG + Intergenic
954297258 3:49681171-49681193 GCCCCAGTGGATGTCGGGAATGG - Exonic
954719219 3:52545986-52546008 GGCCCAGGGCATCACTAGACAGG - Intronic
955916267 3:63911918-63911940 GCCCCAGGGCAGCGCGGGAGAGG - Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967219593 3:187237461-187237483 GCCCCAGGGCATCCAGGGTTGGG + Intronic
967949413 3:194829379-194829401 GGCCCAAGGCCTGACGGGAATGG - Intergenic
972024755 4:34362749-34362771 GCCCTGGGGCATAACAGGAATGG + Intergenic
977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG + Intergenic
985103817 4:186482895-186482917 GTTCCAGGCCATCACTGGAAGGG + Intronic
992267468 5:75033243-75033265 GCCCCAGGCCTTCTCAGGAAGGG - Intergenic
1000036017 5:157448454-157448476 GCCCCAGGGGATGAGGGGAGTGG - Intronic
1000295436 5:159909322-159909344 GCCCCAGGGGAGCAAGGCAAGGG - Intergenic
1001957618 5:175858873-175858895 GCCACAGGGCAGCAGTGGAAGGG + Intronic
1002420269 5:179142674-179142696 ACCCCAGGGCATTAGGGGCAGGG + Intronic
1002492130 5:179586180-179586202 GGCACACGGCATCATGGGAAGGG - Intronic
1002790395 6:433422-433444 GCCCCAGGGCAGCATGAGGAGGG + Intergenic
1005685790 6:28252083-28252105 GCCCCTGGGCATGACAGGAGGGG - Exonic
1007582326 6:42966856-42966878 GCCCTAGGGAACCACAGGAAAGG + Exonic
1008483356 6:52009191-52009213 GCCCCAGGCTATCACCTGAAGGG + Intronic
1008546780 6:52590221-52590243 TCCCCAGGGCATGCCAGGAAAGG - Intergenic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1018957442 6:168419659-168419681 GCCCTAGGGTAGCACAGGAAGGG - Intergenic
1021884373 7:25124684-25124706 GCCCCAGGAGATCACAGGTAGGG - Intronic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1029568745 7:101357455-101357477 GCTGCTGGGCATCACGGTAAGGG - Intergenic
1032074024 7:128827787-128827809 GTCCCAGGGGATCAAGTGAATGG - Intergenic
1033756294 7:144400199-144400221 CCCCCAGCGCATCATGGTAAAGG - Exonic
1035592259 8:824917-824939 GCCACAGGGCATCAGGGGATAGG + Intergenic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1037890233 8:22620174-22620196 TCCCTTGGCCATCACGGGAATGG + Exonic
1038679718 8:29655531-29655553 GCCCCAGGGTAGGAAGGGAAAGG - Intergenic
1048606438 8:135973483-135973505 ATCCCAGGGCAGCAAGGGAAAGG + Intergenic
1049550039 8:143252934-143252956 GCCTCAGGACATACCGGGAACGG - Intronic
1049551556 8:143262136-143262158 GCCCCAGGGCAAGACGGGCGTGG - Intronic
1049594953 8:143479030-143479052 AGCCCAGGGCCTCCCGGGAATGG + Intronic
1051897981 9:22008766-22008788 GCCCCAGGGCCTCGCCGGCAGGG - Intronic
1052424728 9:28290031-28290053 GCACCAGGGCAACACTAGAAAGG - Intronic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG + Intergenic
1060670329 9:125463189-125463211 GCCCCAGTGCAACAATGGAACGG + Intronic
1061272900 9:129553785-129553807 GCTGCAGGGCATCAACGGAAAGG + Intergenic
1062220603 9:135413206-135413228 CCCCCTGCGCATCCCGGGAAAGG - Intergenic
1187737776 X:22322186-22322208 GACCCAGGGCATCAAGAGACAGG - Intergenic
1190167353 X:48084161-48084183 GCCCTAGGGCAGCACTTGAAAGG - Intergenic
1191627415 X:63283801-63283823 GCCCAAGGGCAGCAAGGGCAAGG - Intergenic
1198618459 X:138482189-138482211 GCTCCAGGGCCTCCCGGGGAAGG - Intergenic
1200686381 Y:6263570-6263592 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1200830118 Y:7680874-7680896 GAGGTAGGGCATCACGGGAAAGG + Intergenic
1200989259 Y:9334487-9334509 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1200991922 Y:9354817-9354839 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1200994576 Y:9375097-9375119 GCCGTGGGGCATCATGGGAAAGG - Intronic
1200997239 Y:9395443-9395465 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1200999754 Y:9463980-9464002 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1201002412 Y:9484289-9484311 GCCGTGGGGCATCATGGGAAAGG - Intronic
1201005072 Y:9504576-9504598 GCCATGGGGCATCATGGGAAAGG - Intergenic
1201007730 Y:9524903-9524925 GCCGTGGGGCATCATGGGAAAGG - Intergenic
1201010353 Y:9545093-9545115 GCCGTGGGGCATCATGGGAAAGG - Intergenic