ID: 1018020248

View in Genome Browser
Species Human (GRCh38)
Location 6:159756147-159756169
Sequence GAAAATGCACAGATGTATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018020248 Original CRISPR GAAAATGCACAGATGTATGG TGG (reversed) Exonic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
904226520 1:29025631-29025653 TAACATGCACAGATGTCTGTGGG + Intronic
904823393 1:33259070-33259092 GAAAAGGCTCAGATGTCAGGAGG + Intronic
905216638 1:36413069-36413091 TAGAATGTACACATGTATGGAGG + Intergenic
905935712 1:41822413-41822435 GCATATGCAGAGATGGATGGGGG + Intronic
909819846 1:80048400-80048422 AAAAATGTATAGATGTATGTGGG - Intergenic
911002740 1:93182256-93182278 AAAAATTCTCAGATGTAGGGAGG - Intronic
912177793 1:107182075-107182097 GAAAATGCACATTGGTTTGGGGG - Intronic
912484652 1:110016160-110016182 GAAAATGAAAAGAAGTGTGGAGG + Intronic
912903197 1:113675033-113675055 GAAAATGCGTAGATGAATAGAGG + Intronic
914882681 1:151559778-151559800 GAAAATGAGAAAATGTATGGAGG - Intronic
915541953 1:156572908-156572930 GCGAATGCAGAGATGTATGAGGG + Intergenic
917856779 1:179107677-179107699 GAAAATGCACACATTTCTGAGGG - Exonic
922328575 1:224553679-224553701 GGAAATGCACAGAAGACTGGAGG - Intronic
922463600 1:225831016-225831038 GCCAATGCACAGATGAATGGGGG - Intronic
922463609 1:225831079-225831101 GCCAATGCACAGATGAATGGGGG - Intronic
922780718 1:228250303-228250325 GAAAGTGCACAGAGATATGCTGG - Intronic
922782559 1:228264454-228264476 GAAAGTGCACAGAGATATGCTGG - Intronic
1064009578 10:11724980-11725002 GAAAATGCTGAAATGTATGTTGG - Intergenic
1065767802 10:29047795-29047817 AAAAATGCACATATTTCTGGGGG - Intergenic
1067969814 10:50956948-50956970 GGAAATGCACTGATGTATTTAGG + Intergenic
1068209706 10:53905311-53905333 AAAAATGTACATATGAATGGTGG - Intronic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070525180 10:77290095-77290117 GAATTTTCACAAATGTATGGAGG - Intronic
1072322873 10:94268068-94268090 GATGATGTACAGATCTATGGAGG + Intronic
1072524513 10:96259443-96259465 GAATATGCTCAGAAGTAGGGTGG + Intronic
1073553257 10:104423245-104423267 AAAAATGAACAAATGGATGGTGG - Intronic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075514475 10:123098128-123098150 GAAGATACACAGATACATGGAGG + Intergenic
1076900644 10:133335900-133335922 GCAGATGGACAGATGGATGGCGG + Intronic
1077278749 11:1732347-1732369 AAAGATGCACAAATATATGGAGG + Intergenic
1078114477 11:8431920-8431942 CAAAATGACCAGAGGTATGGAGG - Intronic
1078846457 11:15123076-15123098 GCAAATACAAAGATTTATGGTGG - Intronic
1080290329 11:30664028-30664050 GAAAATGGGAAGATTTATGGCGG - Intergenic
1081019034 11:37920204-37920226 AAAAATGGAGAGATATATGGTGG - Intergenic
1081434437 11:43011499-43011521 GAAAAGGCAGAGAGGTATGGGGG - Intergenic
1083327278 11:61879239-61879261 CACAATGCCCAGATGCATGGGGG + Intronic
1083479501 11:62934469-62934491 GCAAAGGCCCAGATGTAAGGTGG + Intergenic
1084112108 11:67021101-67021123 TCAAATGCACAGATGCATTGTGG - Intronic
1084918161 11:72446925-72446947 GAAAAGGGACAGAAGTAGGGAGG + Intergenic
1085179541 11:74521930-74521952 GAAAATGCTGAGCTGGATGGTGG + Intronic
1091294751 11:134465813-134465835 GTAACTGCCCACATGTATGGGGG + Intergenic
1092998423 12:13972916-13972938 TAATATGCACAGGTGTGTGGGGG + Intronic
1094535748 12:31321695-31321717 GAAAAGGAACACATGTATTGAGG - Intronic
1095917092 12:47490716-47490738 GAAAATGCACACATATAAGCTGG + Intergenic
1097716143 12:62968594-62968616 GAATATTCACAGTTGTATGTCGG + Intergenic
1097979071 12:65718388-65718410 GAAAAAGGACAGATCTAAGGTGG - Intergenic
1098596599 12:72279636-72279658 AAACAGGCACAGCTGTATGGTGG + Intronic
1099083216 12:78212400-78212422 AAAACTGCACAGATGTTTCGTGG - Exonic
1099879506 12:88450621-88450643 AAAAATGCCCAGATTTATGAAGG - Intergenic
1100102365 12:91124431-91124453 GAAAATGCACAGAGGTTAGAGGG - Intergenic
1100925088 12:99536304-99536326 GAAGCTACACATATGTATGGGGG + Intronic
1106774792 13:32998543-32998565 GAAGATGGATAGATTTATGGTGG + Intergenic
1107118202 13:36769728-36769750 GAAAGAGCACAGGTGCATGGAGG + Intergenic
1107463847 13:40630926-40630948 GAAAATCCTCACCTGTATGGAGG - Intronic
1109852919 13:68090653-68090675 GAAAATGGAAAGATGTCTGCTGG + Intergenic
1110416168 13:75255178-75255200 AAAAATTCACAAATGTATGTGGG + Intergenic
1111969247 13:94893688-94893710 GAAAATGCACACAGGTCTGCAGG + Intergenic
1118442949 14:65828420-65828442 AAAAAGGCACAGGTGTGTGGTGG + Intergenic
1120503572 14:85326469-85326491 GAAAATGTACAGCTTTATGTTGG + Intergenic
1120510132 14:85403165-85403187 GAAAATGCATCCATGTAGGGTGG - Intergenic
1120943743 14:89974447-89974469 CAGAATGCACAGATGCATGCTGG + Intronic
1121124868 14:91399475-91399497 GAGAATGCACAGGTGTTGGGAGG - Intronic
1121857973 14:97288089-97288111 GTAAATGGATAGATGGATGGTGG + Intergenic
1123069009 14:105632126-105632148 GAAAATGAGCAGATAGATGGGGG - Intergenic
1123253558 15:17506713-17506735 GAAACTACACAAATGTATTGTGG + Intergenic
1123284299 15:18046820-18046842 GAAACTACACAAATGTATTGTGG + Intergenic
1123466498 15:20520270-20520292 GAAACTGCACAGATGAGTTGGGG + Intergenic
1123651616 15:22480767-22480789 GAAACTGCACAGATGAGTTGGGG - Intergenic
1124403640 15:29374543-29374565 AAAAATGCACCAATGTATTGTGG - Intronic
1124556390 15:30729598-30729620 GAAAATGCAGAGATGTGTGAGGG - Intronic
1124674885 15:31676170-31676192 GAAAATGCAGAGATGTGTGAGGG + Intronic
1124989729 15:34659740-34659762 AAAAATGCACAAAAGTATGATGG + Intergenic
1125118846 15:36128575-36128597 TAAAATGAACAAATGAATGGAGG - Intergenic
1127000398 15:54497314-54497336 GCAAATTGGCAGATGTATGGGGG - Intronic
1127537211 15:59901067-59901089 GAAGATGTCCAGATGTAAGGGGG - Intergenic
1127638021 15:60889513-60889535 CAAAATGCACAGTTGTACGAAGG + Intronic
1127702573 15:61515226-61515248 GAGAATACACAGCTGGATGGTGG + Intergenic
1127739969 15:61893721-61893743 CAGAATGCCAAGATGTATGGGGG + Intronic
1129083124 15:73059238-73059260 GAAAAGGCAGAGAGGTATGGTGG + Intronic
1129924053 15:79346477-79346499 GCAAAGGCACATATATATGGTGG - Intronic
1130179574 15:81611502-81611524 GCAAATGCACAGGTGTGAGGTGG - Intergenic
1132205023 15:99980536-99980558 GAAACTGCACAGATGGATGGAGG + Intronic
1134321125 16:13164776-13164798 GAAAATGCCCAAATATTTGGTGG - Intronic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1137398011 16:48130715-48130737 GAAAATGCTCAGATATGTGGAGG - Intronic
1141091566 16:81133840-81133862 GAACATGGACAGAGGTGTGGAGG - Intergenic
1141459533 16:84169827-84169849 GAAAATGCAAAGGTGAATGTGGG - Intronic
1141792482 16:86246064-86246086 GTCAGTGCACAGCTGTATGGGGG - Intergenic
1143073694 17:4320851-4320873 GAAAACGAAAAGAGGTATGGTGG - Intronic
1144142219 17:12360713-12360735 GAGACTGGACAGATGGATGGAGG + Intergenic
1144167453 17:12626216-12626238 AAAAATGCCCAGACTTATGGTGG + Intergenic
1146421312 17:32688603-32688625 GAAAAAGCAGAGATGTTTGAGGG + Intronic
1146532857 17:33624848-33624870 GAAGGTGAACAGATGTATGATGG - Intronic
1149115393 17:53088330-53088352 AAAAATGCTGAGATGTATTGAGG + Intergenic
1149367790 17:55963104-55963126 AAGAATGCACAGCTGTTTGGGGG - Intergenic
1150962215 17:69926180-69926202 GTAAATTCAAAGATGCATGGCGG + Intergenic
1153033441 18:736226-736248 GTAACTGTACAGAAGTATGGAGG + Intronic
1153717993 18:7870018-7870040 GAAATTGCACAGTGGCATGGTGG + Intronic
1155764096 18:29605780-29605802 GGAAATGCCTAGATGTATAGTGG + Intergenic
1157316228 18:46592281-46592303 GAAAACGCTCAGGTGTTTGGGGG - Intronic
1161294066 19:3510791-3510813 GACAATGCACAGATGTCCCGAGG - Intronic
1162096415 19:8312368-8312390 GGAAATGCACACATCTCTGGGGG + Intronic
1166276894 19:41760410-41760432 GCAAATGCACAGCTGAGTGGTGG - Intronic
1168520434 19:57046065-57046087 GAAAAAGCGCAGATTCATGGAGG + Intergenic
925487802 2:4355311-4355333 AAGAAAACACAGATGTATGGGGG + Intergenic
925853648 2:8108361-8108383 GTAAATGCAGAAATCTATGGAGG + Intergenic
926379683 2:12274386-12274408 GAAAATTCAGAGATGTAAGGTGG - Intergenic
926499850 2:13640736-13640758 AAAAATGCAAAGATGTTTTGAGG - Intergenic
927362852 2:22256549-22256571 GAAAATGTACATATATATGACGG - Intergenic
933877723 2:86635514-86635536 GAAAATGCCCAGAACTATTGAGG - Intronic
935712873 2:105914528-105914550 AAATGTGCACAGATCTATGGGGG - Intergenic
938627611 2:133128395-133128417 GTAAATGCACAGTTTTCTGGGGG + Intronic
940556969 2:155241080-155241102 AAAAATGCACAGAAGTATTTAGG + Intergenic
941910573 2:170760637-170760659 GAAAATACAAAGATCTATGGTGG + Intergenic
942205877 2:173619732-173619754 GAAAATGAACGGATTCATGGGGG - Intergenic
942798277 2:179846885-179846907 CAAATGGCACAGCTGTATGGTGG - Intronic
945451248 2:209999032-209999054 GACAATTCAAAGATTTATGGAGG - Exonic
946503037 2:220269817-220269839 GGAGATCCACAGATGTGTGGTGG + Intergenic
946771524 2:223093414-223093436 GAAAATGGACATATGTGTCGTGG + Intronic
1169003268 20:2183983-2184005 GAAAATGCACTGGTGTCTTGGGG + Intergenic
1169780522 20:9305039-9305061 GAAAATGCAGGGATGTTGGGGGG - Intronic
1171253790 20:23670678-23670700 GAAGAGGCAAAGATCTATGGTGG - Intergenic
1173244146 20:41323132-41323154 GAAAATGTACAGCTGTACAGTGG - Intergenic
1174282503 20:49449405-49449427 GAAAGTTCACAGGTGAATGGAGG + Intronic
1175320407 20:58083063-58083085 GAAAATGCAGAATTATATGGTGG + Intergenic
1175972122 20:62692006-62692028 GAAGAGGCACAGAGGTCTGGGGG - Intergenic
1176986955 21:15448472-15448494 GAAAATACACATATTTTTGGAGG - Intergenic
1178999635 21:37444790-37444812 GAAAACTCACAGTTGAATGGTGG + Intronic
1180741762 22:18058167-18058189 GCAACTGCAGAGATGTAGGGTGG + Intergenic
1185025452 22:48407463-48407485 GAAAAGGAACAGTTGTATAGTGG - Intergenic
949187190 3:1206334-1206356 GAAAATACACTGATGCATGTGGG - Intronic
958185179 3:90110836-90110858 GGAAAAGCACAGATTTAGGGTGG + Intergenic
960882146 3:122355947-122355969 GAGAATGCACAGATGTTCAGAGG + Intergenic
961246166 3:125455653-125455675 GAAAAGTCACAGATATATGTGGG - Intronic
962246908 3:133803205-133803227 GATAATTGACAGATCTATGGAGG - Intronic
962888290 3:139648376-139648398 GAAAATGGACTGATATATGTAGG + Intronic
966102423 3:176287077-176287099 GATATTGGACAGATGTTTGGTGG + Intergenic
967515474 3:190363868-190363890 GAAAATGATCAGAAGTCTGGAGG - Intronic
967543417 3:190695421-190695443 CTAAATGCACAGATGTGTGTGGG - Intergenic
968168870 3:196492037-196492059 GAAAGTTCAGAGATGAATGGTGG + Intronic
974636785 4:64574074-64574096 GAAAAGGAACTGATTTATGGTGG - Intergenic
978608479 4:110508978-110509000 GAAAATGCTCAGATGATTAGTGG - Intronic
980067094 4:128201589-128201611 GAACATGCACAGATGTCCAGAGG - Intronic
980861208 4:138501494-138501516 GAAAAAGCAGTGATGTATGGTGG + Intergenic
981576422 4:146210655-146210677 GAAAGTGCACAGTAGCATGGAGG + Intergenic
984642163 4:182178868-182178890 GAAAATTTACAGATGTATACAGG - Intronic
986598651 5:9449368-9449390 GAGAATGCATGGATATATGGGGG + Intronic
987876238 5:23685067-23685089 GAATATGCACACATTGATGGGGG - Intergenic
987879269 5:23720544-23720566 GAAAATGCACAGCAGTGTAGGGG - Intergenic
989024994 5:37057150-37057172 GAAAAAGCACACATGTTTAGCGG - Intronic
989300083 5:39880891-39880913 GAAAATGCAGAGAAGCCTGGTGG - Intergenic
989845068 5:46131181-46131203 GGAAATGCACAGTATTATGGTGG - Intergenic
990061588 5:51656566-51656588 GAAAATCCAAAGAAGTTTGGTGG + Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
994382490 5:99087858-99087880 GAAGATGCTCATATGCATGGGGG + Intergenic
995629014 5:114112698-114112720 GAAAATGCAAATAAGTATGTGGG + Intergenic
996777639 5:127150016-127150038 GGAAATGTGCAAATGTATGGTGG - Intergenic
997636505 5:135410823-135410845 GGAAATGCAAACATGTCTGGGGG - Intergenic
997842840 5:137257712-137257734 GAAGATGGGCAGATGTTTGGAGG - Intronic
1001223599 5:169925106-169925128 TAAAAAGAACAGATGAATGGGGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1003329003 6:5113965-5113987 GAAAATGGAGAGATGGATGCTGG - Intronic
1003577872 6:7314227-7314249 GAAAAAGCACAGCTCTAAGGAGG - Intronic
1004559632 6:16735465-16735487 GAAGATGCCCAAATGAATGGAGG + Intronic
1005615660 6:27570276-27570298 AAAAATACACGGATGTGTGGAGG + Intergenic
1007949625 6:45859871-45859893 GAAATTGCACTTATGTTTGGAGG + Intergenic
1008312974 6:50000803-50000825 GAAAATGCTGAAATATATGGTGG - Intergenic
1008389236 6:50930521-50930543 GTAAATGTACAGATATATGTAGG - Intergenic
1009291181 6:61884849-61884871 GAAAATACACATCTCTATGGGGG - Intronic
1010025631 6:71212868-71212890 GAAGATACACACATGTAGGGAGG + Intergenic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1015074800 6:129142918-129142940 CAAAATGCACAAATATATGAGGG - Intronic
1015606468 6:134960873-134960895 GAAAGGGCACAGATGTACTGGGG - Exonic
1015953179 6:138574433-138574455 GAGTGTGCACAGATGTGTGGCGG - Intronic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1022008481 7:26288892-26288914 GAACATTTACAGGTGTATGGAGG - Intergenic
1022234870 7:28451687-28451709 GCATGTGCACAGAAGTATGGCGG + Intronic
1023294133 7:38697646-38697668 TAAAATACACAGATGAATGTGGG + Intergenic
1024806080 7:53141660-53141682 GAAAACACACAGCTGTATGTTGG - Intergenic
1026144223 7:67731727-67731749 GAAAAAGGCCAGGTGTATGGTGG - Intergenic
1026217268 7:68360723-68360745 GCAAATGCACACAGGTAGGGAGG - Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028069903 7:86438528-86438550 GAAAATCCACAGATCTCAGGTGG + Intergenic
1041380675 8:57251520-57251542 GAAAATGCAGAGTTCTGTGGTGG - Intergenic
1043484889 8:80689085-80689107 CAAAATGCACATAAATATGGAGG - Intronic
1043681455 8:83031124-83031146 GAAAATGTAAAAATGTATAGTGG - Intergenic
1044429164 8:92088529-92088551 GAAATAGCACAGCTGTATTGTGG - Intronic
1044758555 8:95492655-95492677 GAAAATGCTCAGAGAGATGGTGG - Intergenic
1044797888 8:95922454-95922476 GTAAAAGCAGAGAGGTATGGAGG - Intergenic
1045357341 8:101401414-101401436 AAAAGTGCACAGCTGTTTGGGGG + Intergenic
1046137900 8:110054299-110054321 GGAAATGCTTAAATGTATGGAGG + Intergenic
1047257693 8:123228076-123228098 GAGGATGCACAGGTGGATGGTGG - Intronic
1049467968 8:142761810-142761832 GAACATGCGCAGGTGTCTGGGGG + Intergenic
1050146287 9:2571490-2571512 GAAACTGCACACATGTATCAGGG - Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056349538 9:85735437-85735459 GAAGTTCCATAGATGTATGGTGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058082067 9:100711390-100711412 GAAAATGGACTGATGCAAGGAGG - Intergenic
1058171226 9:101683486-101683508 GAAAATCCACAGATGTTTTATGG + Intronic
1058759308 9:108114862-108114884 GAAAATGCAAGGGTCTATGGAGG + Intergenic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1185558956 X:1043984-1044006 GTATATGCACATATGTATGCGGG + Intergenic
1186400700 X:9256822-9256844 TAAAATGCATAGATGGATGATGG + Intergenic
1188169720 X:26910065-26910087 GAAAAAGCACAGATATAGAGAGG + Intergenic
1188230813 X:27660696-27660718 GGCAGTGCACAGATGTAGGGTGG + Intronic
1189286698 X:39856838-39856860 GAAAATGCACAGCTTTCCGGGGG + Intergenic
1190157031 X:48002626-48002648 GAAAAAGCAGAGATGTGTGACGG + Exonic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1194084489 X:89509300-89509322 GAAAATGCACATAAGGCTGGAGG - Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1197622628 X:128767788-128767810 GAAGATGGACAGATTTTTGGGGG - Intergenic
1198688482 X:139253080-139253102 GGAAATGCACAGTAGTGTGGGGG + Intergenic
1199119615 X:144036112-144036134 CAAAATGCACAGGCGTAGGGTGG + Intergenic
1199140129 X:144301405-144301427 CCAAATGCACAAATGTAAGGAGG - Intergenic
1199944624 X:152655324-152655346 GAGACAGCACAGATGGATGGAGG - Exonic
1200437130 Y:3165186-3165208 GAAAATGCACATAAGGCTGGAGG - Intergenic
1201080840 Y:10243120-10243142 AAAACTGCACAGAAGTAGGGGGG - Intergenic