ID: 1018023723

View in Genome Browser
Species Human (GRCh38)
Location 6:159788519-159788541
Sequence GCTCGCTTTGTTTAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018023723_1018023734 19 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023734 6:159788561-159788583 TGCGGGGTGGAATCTGATGGCGG 0: 1
1: 1
2: 3
3: 9
4: 197
1018023723_1018023736 21 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023736 6:159788563-159788585 CGGGGTGGAATCTGATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 55
1018023723_1018023729 1 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151
1018023723_1018023730 2 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023730 6:159788544-159788566 ATTTGGCACAGCTTTGATGCGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1018023723_1018023735 20 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023735 6:159788562-159788584 GCGGGGTGGAATCTGATGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 86
1018023723_1018023733 16 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023733 6:159788558-159788580 TGATGCGGGGTGGAATCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 97
1018023723_1018023731 3 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023731 6:159788545-159788567 TTTGGCACAGCTTTGATGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 79
1018023723_1018023732 6 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023732 6:159788548-159788570 GGCACAGCTTTGATGCGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018023723 Original CRISPR GCTCGCTTTGTTTAGGGACA GGG (reversed) Intronic