ID: 1018023724

View in Genome Browser
Species Human (GRCh38)
Location 6:159788520-159788542
Sequence GGCTCGCTTTGTTTAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018023724_1018023730 1 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023730 6:159788544-159788566 ATTTGGCACAGCTTTGATGCGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1018023724_1018023735 19 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023735 6:159788562-159788584 GCGGGGTGGAATCTGATGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 86
1018023724_1018023732 5 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023732 6:159788548-159788570 GGCACAGCTTTGATGCGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 114
1018023724_1018023734 18 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023734 6:159788561-159788583 TGCGGGGTGGAATCTGATGGCGG 0: 1
1: 1
2: 3
3: 9
4: 197
1018023724_1018023731 2 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023731 6:159788545-159788567 TTTGGCACAGCTTTGATGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 79
1018023724_1018023736 20 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023736 6:159788563-159788585 CGGGGTGGAATCTGATGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 55
1018023724_1018023733 15 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023733 6:159788558-159788580 TGATGCGGGGTGGAATCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 97
1018023724_1018023729 0 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018023724 Original CRISPR GGCTCGCTTTGTTTAGGGAC AGG (reversed) Intronic
900240323 1:1614203-1614225 GACTCCATTTGTTTAGGGATTGG - Intergenic
918013717 1:180612160-180612182 GGATGGCTTTGTTTAGGGAAAGG - Intergenic
921832631 1:219745222-219745244 GGCTTGAGTTGTTTAGGGCCAGG - Intronic
1071579052 10:86753889-86753911 GTCTCTCTTTTTTTAGAGACAGG - Intergenic
1071977258 10:90967565-90967587 GGTTTTCTTTTTTTAGGGACAGG - Intergenic
1084578388 11:70006103-70006125 GGGTAGGTGTGTTTAGGGACCGG - Intergenic
1084902674 11:72321536-72321558 GGCTCGCTTTGCTTAGAGGTGGG + Intronic
1086907753 11:92436485-92436507 AGATCCCTTTGTTAAGGGACAGG + Intronic
1088327100 11:108612158-108612180 GGCTCATTTTCTTTATGGACAGG - Intergenic
1090807151 11:130209777-130209799 GGCTCCCTCTGTTTCGGGACTGG + Exonic
1096329131 12:50693929-50693951 GGCTGGGTCTGTTTGGGGACAGG + Intronic
1096619900 12:52857789-52857811 GGCTGTCATTGTTTAGGGTCAGG - Intergenic
1099194526 12:79599713-79599735 AGCTTGATGTGTTTAGGGACAGG - Intronic
1105514608 13:21078013-21078035 GGCTCCCTTTGTTCAGAGTCCGG - Intergenic
1107202052 13:37733265-37733287 GGCTCGCTGTGTTTTGGGACTGG - Intronic
1108066127 13:46579056-46579078 GGCTCGCTGTGTGCAGGGAAAGG + Intronic
1111137556 13:84068196-84068218 GTCTCGCTTTGTTGAGAGGCTGG - Intergenic
1116119151 14:40699808-40699830 GGCTAGGTTTGTTTTGGGAGAGG - Intergenic
1118789268 14:69074591-69074613 GGCTTTCTTTGTTGATGGACAGG - Intronic
1120027871 14:79606063-79606085 GGCTCTCTTTGTTTGAGGATTGG + Intronic
1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG + Intronic
1128537386 15:68501326-68501348 TGCTGGCTTTGTTCAGGGAAGGG + Intergenic
1132087996 15:98923578-98923600 GGCTTTTTTTGTTGAGGGACTGG + Intronic
1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG + Intergenic
1136055541 16:27686049-27686071 AGCTGGCCTTGTTTAGGGTCAGG + Intronic
1143868222 17:9939470-9939492 GCCTCCCTTTGTCTAGGGGCAGG - Intronic
1161717871 19:5886923-5886945 GCCTCTCTTTTTTTAGAGACAGG + Intronic
1163466834 19:17472823-17472845 GGCTCCCTTTTTTTTGAGACAGG + Intronic
1167174037 19:47853133-47853155 AGCTTGCCTTGTTTAGGGACAGG - Intergenic
927718505 2:25368003-25368025 AGCTGACTTTCTTTAGGGACGGG + Intergenic
929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG + Intronic
930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG + Intronic
932142228 2:69290043-69290065 GAGTTGCTTTTTTTAGGGACTGG + Intergenic
934730572 2:96654000-96654022 GGCTCCCTTTGGTTAGGGAATGG - Intergenic
944220201 2:197295886-197295908 GGCTCACTTTTTGTAGGGACAGG - Intronic
1178918746 21:36724282-36724304 GGGTCTTTTTGTTAAGGGACAGG + Intronic
1180980758 22:19877005-19877027 GGCTGGCTCTGTTTGAGGACAGG - Intronic
953904433 3:46861349-46861371 GGCTGGCTTTGCTTGGGGCCTGG + Intronic
959759813 3:109947461-109947483 GGCTAGCTATGTCTAAGGACGGG + Intergenic
962704792 3:138032618-138032640 GTTTTGCTTTGTTTAGAGACGGG + Exonic
972741753 4:41893648-41893670 GGCTCAATTTTTTTAGAGACAGG - Intergenic
981516594 4:145616983-145617005 GACTGGCTTTTTTTAGGGATAGG - Intergenic
983973470 4:173902535-173902557 GTTTCGTTTTGTTTAGTGACCGG + Intergenic
984757240 4:183336464-183336486 GGCTCGGTTTGTTGAGAGAATGG - Intergenic
1002772898 6:304415-304437 GACTCGCTGGGTTTAGGGCCCGG - Intronic
1005580202 6:27226866-27226888 AGCTTTCTTTCTTTAGGGACAGG - Intergenic
1008490214 6:52078529-52078551 GTGTCTCTTTGTTTTGGGACTGG - Intronic
1011017702 6:82776242-82776264 GACTCACTTTGTTTTGGAACTGG - Intergenic
1018023724 6:159788520-159788542 GGCTCGCTTTGTTTAGGGACAGG - Intronic
1019164521 6:170089053-170089075 GGCTAACTTTTTTTAGAGACAGG - Intergenic
1019878618 7:3838656-3838678 AGATCGCTGTGTTCAGGGACGGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1022439401 7:30420652-30420674 GGCTGGGTTTGTTTAGGCAAAGG + Intergenic
1026592189 7:71706583-71706605 GGCAGACATTGTTTAGGGACGGG + Intronic
1028331716 7:89603223-89603245 GGCTTGCTATTTTTAGGGCCAGG - Intergenic
1030058473 7:105603544-105603566 GGCTACCTTTTTTTAGGGACAGG + Intergenic
1034406956 7:150910869-150910891 GGCTCGCCTTGTTTTTGGACTGG + Intergenic
1034792911 7:153988025-153988047 AGCTCTGGTTGTTTAGGGACTGG - Intronic
1035650273 8:1258697-1258719 AGCTGGCTTTGTTTATGGAAGGG + Intergenic
1043588494 8:81797651-81797673 GGCTAGTTTTTTGTAGGGACGGG + Intergenic
1045743915 8:105394295-105394317 TGCTGCCTTTGTTTAGGGAAGGG + Intronic
1051264967 9:15301169-15301191 GGCTTCCCTTGTTTAGGGTCCGG - Intronic
1051660570 9:19422594-19422616 TCCTCGCTTTGTGTAGGCACAGG + Intronic
1052936813 9:34100033-34100055 GTCTCTCTTTTTTTAGAGACAGG + Intronic
1059920598 9:119156283-119156305 GGTTCCCTTTCTTCAGGGACAGG + Intronic
1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG + Intronic
1062416146 9:136451295-136451317 GGGTCTCTTTGTTTCGGGAGCGG + Exonic
1062628618 9:137453969-137453991 GGCTCGGTTGGTTCAGGGGCAGG + Intronic
1192551840 X:72060801-72060823 AGCTCGCTTTGCATAGTGACAGG + Intergenic
1197959601 X:131989695-131989717 GGCTTCCCTTGTTTAGGGAAGGG - Intergenic
1199461850 X:148093868-148093890 GGCTGGCTTTCTTGTGGGACTGG - Intergenic