ID: 1018023729

View in Genome Browser
Species Human (GRCh38)
Location 6:159788543-159788565
Sequence TATTTGGCACAGCTTTGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018023723_1018023729 1 Left 1018023723 6:159788519-159788541 CCCTGTCCCTAAACAAAGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151
1018023726_1018023729 -6 Left 1018023726 6:159788526-159788548 CCTAAACAAAGCGAGCCTATTTG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151
1018023724_1018023729 0 Left 1018023724 6:159788520-159788542 CCTGTCCCTAAACAAAGCGAGCC 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151
1018023725_1018023729 -5 Left 1018023725 6:159788525-159788547 CCCTAAACAAAGCGAGCCTATTT 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1018023729 6:159788543-159788565 TATTTGGCACAGCTTTGATGCGG 0: 1
1: 1
2: 2
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018023729 Original CRISPR TATTTGGCACAGCTTTGATG CGG Intronic