ID: 1018027340

View in Genome Browser
Species Human (GRCh38)
Location 6:159816465-159816487
Sequence CTGTGGATGGTGAGCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018027335_1018027340 5 Left 1018027335 6:159816437-159816459 CCATGGGAGGTTGTATGAGCTGC 0: 1
1: 0
2: 2
3: 14
4: 135
Right 1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG 0: 1
1: 0
2: 1
3: 18
4: 250
1018027331_1018027340 26 Left 1018027331 6:159816416-159816438 CCTGGAGAAGGGTATGCAGGACC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG 0: 1
1: 0
2: 1
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018027340 Original CRISPR CTGTGGATGGTGAGCTAGGA TGG Intronic
902575016 1:17372240-17372262 CTGAGGATGGTCAGCGTGGAGGG + Exonic
903407078 1:23106813-23106835 CTGTGGAGGGTGGGGAAGGATGG - Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
908184038 1:61634539-61634561 CTCTGGAGGCTGAGATAGGAGGG + Intergenic
908660568 1:66431243-66431265 CTGTTGCTGGTGAGCTAGTGTGG + Intergenic
911502593 1:98706771-98706793 CTGTGGATCGTGAGCCAATAAGG + Intronic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915661826 1:157411244-157411266 CTGTGCCTGGTGGGCAAGGAAGG + Intergenic
915856196 1:159388996-159389018 CTGGGGAAGGTGAGCTTGAAGGG + Intergenic
916504805 1:165418822-165418844 CTGTGGCTGGTGTGCTATTATGG + Intronic
916611797 1:166398700-166398722 CTGTGGGAGGTGGGATAGGAGGG - Intergenic
917501798 1:175592438-175592460 CTGTGGATGGTGATCCACGTAGG + Intronic
918311413 1:183288036-183288058 CTGTGGCTGGTGGGGTGGGAGGG + Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
922475781 1:225906157-225906179 CTGTAGATGGTGAGCCAGCCTGG + Intronic
922701869 1:227765932-227765954 CTGTGGAGGGTGGGGTTGGAAGG + Intronic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
923758471 1:236816601-236816623 CTGTGGAGTGTGACCTGGGAGGG + Intronic
924700301 1:246444564-246444586 TTGTGAATGGAGAGGTAGGAAGG + Intronic
1064647874 10:17478675-17478697 GTTAGGATGGTGAGCCAGGATGG - Intergenic
1067979410 10:51067176-51067198 CTGTGGGAGGTGGGATAGGATGG + Intronic
1069262380 10:66414831-66414853 CTGGGGATGGTGCTCTAGAATGG - Intronic
1070669999 10:78371081-78371103 CTTTGGGTGGTGAGGTTGGAAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1073035858 10:100563797-100563819 CGGTGGGTGGTGAGCTTTGATGG + Intergenic
1073267840 10:102239091-102239113 CTCTGGAAGGTGAGACAGGATGG - Intronic
1074153206 10:110776883-110776905 TTGTAGATAGTGACCTAGGAAGG + Intronic
1076412582 10:130262505-130262527 CAGTGGATGGTGAGCCATGGGGG + Intergenic
1079994585 11:27282178-27282200 GTCTGGATGGAGAGCAAGGAGGG + Intergenic
1081678040 11:44982387-44982409 CTGAGAATGGTGAGCTATGTGGG - Intergenic
1081687615 11:45053752-45053774 CTGTGGAGGGTGATCCAGGATGG - Intergenic
1082877548 11:58003344-58003366 CTGTGGCTGGAGAGATAGGGTGG - Intergenic
1083222551 11:61262657-61262679 CTGTGGATGATGAGCTTTTAGGG - Intronic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1085023360 11:73222571-73222593 CTGTGGAGGGTGAGGTGGCATGG - Intronic
1085122888 11:73978523-73978545 TTGGGGATGGTGAGCAGGGAGGG - Intronic
1085258389 11:75190298-75190320 CTGTGGCTGGTGAGCCAGCCTGG + Intronic
1085928252 11:81049102-81049124 TTGAGGATGGTGAGCTAAGGAGG - Intergenic
1088187463 11:107187703-107187725 ATGTGGATGGTCAGCTACTATGG - Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1091802010 12:3330339-3330361 CTGCAGATGGGCAGCTAGGAGGG + Intergenic
1091931721 12:4401827-4401849 CTCTGGATGCTGAGCCAGGCAGG + Intergenic
1092418216 12:8308380-8308402 CTGGGGATCCTGAGCTAGGGAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093229537 12:16526762-16526784 CTGTGAAAAGTGAGCCAGGAAGG + Intronic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1094423269 12:30294662-30294684 CAGTGGATGGCGAGCTAGAGAGG + Intergenic
1096490241 12:52009067-52009089 GTGTGGATGTGGAGCTGGGAAGG + Intronic
1096816549 12:54205418-54205440 CTGTAGATGGTGAGCTGGGCAGG - Intergenic
1097156394 12:57015377-57015399 CTGTGAGGGGTGAGCTAGGGTGG - Intronic
1097209143 12:57351451-57351473 CTGTGGATGGTGAGTACTGAGGG + Intronic
1097756565 12:63413588-63413610 CTGTACATGGTGAGAGAGGAAGG + Intergenic
1098161667 12:67651178-67651200 CTGTGGATGGTATAGTAGGATGG + Intronic
1102587137 12:113931386-113931408 CTGTGGCTGGTGTGCTTCGAAGG + Intronic
1103199309 12:119073726-119073748 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1103593874 12:122011256-122011278 CTGTGGCTGGTGTCATAGGAAGG - Intergenic
1104944637 12:132410149-132410171 GTGTGGATGGTGAGCTCCGGGGG - Intergenic
1105893433 13:24698649-24698671 TCGTGGATGGAGAGCTGGGAAGG - Exonic
1108589217 13:51897301-51897323 CTTTGGAGGCTGAGATAGGATGG - Intergenic
1109202891 13:59450662-59450684 CTGTGGATGGGGAATTAGAATGG - Intergenic
1111184860 13:84720428-84720450 AGGTGGATGGGGAGCCAGGAGGG - Intergenic
1112027153 13:95421583-95421605 CAGTAGGAGGTGAGCTAGGAAGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114733521 14:25019631-25019653 CTGAGGATGATGAGCAAAGATGG - Intronic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1118203624 14:63701086-63701108 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1118639014 14:67775040-67775062 CTGCTGATGGTGATCTAGGGAGG + Exonic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119574334 14:75704875-75704897 ATGTGTATGGTGAGCAAGGGAGG + Intronic
1120188334 14:81417311-81417333 GTGTGGATGGTGATGTGGGAGGG - Intronic
1122145424 14:99685757-99685779 CTGTGGCTGGTGACATAGGGAGG + Intronic
1122450059 14:101798706-101798728 CTGTGGAAGGTATGCTAGGTGGG + Intronic
1122740930 14:103871343-103871365 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
1202862412 14_GL000225v1_random:90762-90784 CGGTGGCTGGTGAGGTGGGAGGG + Intergenic
1125933706 15:43617469-43617491 CTGTTGAAGGTTACCTAGGAGGG + Exonic
1125946804 15:43716931-43716953 CTGTTGAAGGTTACCTAGGAGGG + Intergenic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1127112378 15:55688465-55688487 CTGAGGATGGTGATCTAAGCTGG - Intronic
1127453592 15:59139037-59139059 CTGTGGATGGTCACTTGGGATGG + Intronic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1128734481 15:70045163-70045185 CTCAGGATGGAAAGCTAGGAGGG - Intergenic
1129825884 15:78634740-78634762 CTGTGGATGGGGACATGGGAAGG + Intronic
1130067673 15:80618259-80618281 ATGTGGAGGATGAGCTAGAAGGG - Intergenic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1133803406 16:9103710-9103732 CTGTAGATGGTGGGAGAGGATGG + Intronic
1135120514 16:19762246-19762268 CCGTGGGTGGAGAGCTAGCAGGG + Intronic
1136019321 16:27430019-27430041 CAGTGGAGGGTGAGCCAGGCGGG - Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1137519069 16:49176363-49176385 CTATGGCTGCTTAGCTAGGAGGG + Intergenic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1137797278 16:51232635-51232657 CTCTGGATGCTAAGGTAGGAGGG - Intergenic
1138110061 16:54316646-54316668 CCCTGGATGGTGAGCTAGAGCGG - Intergenic
1139371254 16:66470868-66470890 CTGTGGATGGTGATTTGGGAAGG - Intronic
1140019195 16:71221185-71221207 CTGGGAATGGTGGGATAGGAAGG - Intronic
1140514363 16:75531494-75531516 CAGTTGATGGGGAGCTGGGATGG + Exonic
1141134125 16:81454856-81454878 ATCTGGATGGAGAGGTAGGATGG + Intronic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1143197842 17:5089761-5089783 CTGGGGAGGCTGAGGTAGGAGGG - Intronic
1143552027 17:7636266-7636288 CTGTGGAGTGTGAGCCAGCAGGG + Intergenic
1143613166 17:8032146-8032168 CTCAGGAGGGTGAGGTAGGAAGG + Intergenic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1146574409 17:33978833-33978855 CTATGGAGGGAGAGCGAGGAGGG + Intronic
1148189535 17:45668844-45668866 GTGTGTAGGGTGACCTAGGAAGG - Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149278323 17:55071118-55071140 CTGTAGATGGTGGGCAAGGGTGG - Intronic
1149999697 17:61426024-61426046 CTGTGTATGCTGACTTAGGAGGG + Intergenic
1150855150 17:68745289-68745311 AGGTGGATGGGGAGCTAGAAAGG - Intergenic
1150931521 17:69590235-69590257 GGGTGGATGGGGAGCTGGGAAGG + Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1151282342 17:73086115-73086137 TTGGGGATGGTGAGATTGGAAGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG + Intronic
1155755585 18:29490917-29490939 CTGTGTCTTGTGATCTAGGATGG + Intergenic
1157716901 18:49894182-49894204 CAGTGGATGGGGATCTAAGAGGG - Intronic
1158392204 18:57052857-57052879 CTGTGCCTGGTGAGCTGGGCTGG + Intergenic
1161391822 19:4025117-4025139 CCGTGGATAGTGAGGTGGGATGG + Intronic
1161868025 19:6848899-6848921 CTGGGGAGGCTGAGCTAGGAGGG - Intronic
1161933071 19:7354065-7354087 CTTTGGAGGCTGAGCCAGGAGGG + Intronic
1163221222 19:15922577-15922599 CTGTGGGTGGTGGGCTCTGATGG - Intronic
1165314177 19:35044836-35044858 GTGTGGAGGGTGCGCTAGAAGGG + Intronic
1167327832 19:48836276-48836298 CTGTGGAGTGTGAGAAAGGAAGG - Intronic
1168726133 19:58583168-58583190 CTGTGGTAGGTGAGCTAGTGAGG + Intergenic
925055873 2:857021-857043 CTGTGGATGGTATGCTTGGATGG - Intergenic
925055879 2:857062-857084 CTGTGGATGGTATGCTTGGATGG - Intergenic
925055889 2:857130-857152 CTGTGGGTGGTACGCTTGGATGG - Intergenic
926013572 2:9427766-9427788 GAGTGGATTGTGAGCTAGAATGG + Intronic
926627575 2:15105525-15105547 CTAAGGATAGTGAGCTAGGAGGG - Intergenic
927287623 2:21372842-21372864 TTGTGGATTGTGAGCTCGCAGGG - Intergenic
927904171 2:26845611-26845633 ATGGGGATGGTGAGTTAGGCAGG - Intergenic
928033470 2:27800675-27800697 CTATGGATTGTGCCCTAGGATGG - Intronic
932831803 2:74997412-74997434 TTGTGGATGGTGAGGTTGTATGG + Intergenic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
936008553 2:108910398-108910420 CTGTGGATCCTGAGCAGGGAGGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
941928377 2:170917532-170917554 CTGTGGATGGTGAGACTGAAAGG - Intergenic
942061703 2:172233987-172234009 CGGTGGATGGTGAGCTACCAAGG - Intergenic
942612630 2:177757712-177757734 CTGTGGATGCTGCTCTGGGAAGG + Intronic
944708157 2:202311744-202311766 CTCAGGAGGGTGAGGTAGGAGGG + Intergenic
945134731 2:206614993-206615015 CAGTGTATGGTGGCCTAGGAGGG + Intronic
945168208 2:206968405-206968427 CTTTGGATGGTGAGATAGGCGGG + Intronic
946785438 2:223238767-223238789 CTGAAGATGTTGAGCTTGGAGGG + Intergenic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
948698582 2:239746820-239746842 CGGGGGAAGGTGAGGTAGGATGG + Intergenic
1172603147 20:36197290-36197312 TTGTGCATGTTGGGCTAGGAGGG + Intronic
1172783672 20:37451966-37451988 CTGAGGATGGGGAGCTGGGCAGG - Intergenic
1173549224 20:43920826-43920848 CTGTGGAGGGTGCACTGGGAGGG + Intronic
1173853693 20:46235736-46235758 GTGTGGATGGTGAGACAAGATGG - Intronic
1174255242 20:49249551-49249573 GTGAGGATGGTGATCTGGGAAGG + Exonic
1176273616 20:64249773-64249795 CTCTGGAGGCTGAGGTAGGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1178640111 21:34338532-34338554 CTGTAGATGCTGGGCTAAGAGGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180197910 21:46208474-46208496 CTGTGGGTGGTGAGCTAAACAGG - Intronic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1182150039 22:28021383-28021405 CTGGGGAGGGGCAGCTAGGAAGG + Intronic
1182744681 22:32596505-32596527 CTGAGGAAGGTGGGCTGGGAGGG + Intronic
1183381709 22:37493532-37493554 CTGTGTGTGGTGTGCTTGGAGGG - Intronic
1184352318 22:43952327-43952349 CTGGAGAGGGTGTGCTAGGAGGG - Intronic
949189370 3:1233312-1233334 TTGAAGATGGTGAGCTAGGCAGG + Intronic
950286371 3:11748484-11748506 CTTGGGAGGGTGAGGTAGGAGGG - Intergenic
950508010 3:13407670-13407692 CTGTGTTTGGTGAGCTAAGAAGG - Intronic
951643602 3:24863274-24863296 CTGTGGCTGGTTAGCTCGGTTGG - Intergenic
951686440 3:25349865-25349887 CTGTGTAGGGTCAGCTAGGGTGG + Intronic
953666018 3:44927208-44927230 CTGTGGATGGAGTACTATGAAGG + Intronic
954109389 3:48425564-48425586 CTGGGAAAGGTCAGCTAGGAAGG + Intronic
954318906 3:49817563-49817585 CTGAGGAGGCTGAGGTAGGAGGG + Intergenic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960640486 3:119818026-119818048 GTGTGGATGCTGAGCTGTGATGG + Exonic
963323836 3:143839223-143839245 AAGTTGATGGTGAGCTAGTATGG - Intronic
963348885 3:144128817-144128839 CTGTGGAGGGTGAGTTCAGAAGG - Intergenic
963706371 3:148693073-148693095 CTGAGTATGGTGACCCAGGAGGG - Intergenic
964439204 3:156688266-156688288 CTGGGGATGCTGAGGTGGGAGGG + Intronic
964714746 3:159710181-159710203 CTGTGGATGGTCACTTAGGTTGG - Intronic
966411135 3:179647079-179647101 CTGAGGAGGCTGAGGTAGGAAGG + Intergenic
967089958 3:186126769-186126791 TGGTGGGAGGTGAGCTAGGAAGG + Intronic
968702714 4:2064449-2064471 CTGTGCTTGGTGAGCAAGGCTGG - Exonic
969409949 4:7021487-7021509 CTCAGGAGGCTGAGCTAGGAGGG + Intronic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
973661990 4:53117583-53117605 CAGTGGATGGTGGGATGGGAAGG - Intronic
974023102 4:56709050-56709072 ATGTGGATTGTGAGCCAGGGTGG + Intergenic
975448761 4:74500263-74500285 CTGTGGCTGTTCAGCTAGAAGGG + Intergenic
981310522 4:143293750-143293772 CTGTGGATGTTTCTCTAGGATGG - Intergenic
985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG + Intergenic
987016184 5:13822356-13822378 CTCTGGATGCTGAGGTGGGAGGG - Intronic
987341625 5:16944508-16944530 CTGTGTCTTGTGATCTAGGATGG + Intergenic
988324574 5:29746188-29746210 CTGCTGATGGTCAGCTAGGTGGG - Intergenic
989035050 5:37162118-37162140 CTAGTGAAGGTGAGCTAGGAAGG - Intronic
990408984 5:55521560-55521582 CTTTGGAAGGTGAGATAGGCAGG - Intronic
991236317 5:64402873-64402895 CTGTTGATGGTGGGCTTTGAAGG - Intergenic
991425722 5:66489730-66489752 CAGTGGATGGGGAGCTGGAAAGG + Intergenic
993143911 5:84070112-84070134 AGGTGGATGGGGAGCCAGGAGGG - Intronic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996290590 5:121847407-121847429 CTCTGGATAGTCAGCTAAGAGGG + Intergenic
997886674 5:137636767-137636789 CTGTGTAGGGTAAGGTAGGAGGG - Intronic
999791610 5:154945130-154945152 GTGGGGATGGGGAGCAAGGATGG + Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1002077453 5:176717431-176717453 CTGTGGAGGGTGAGATATGATGG - Intergenic
1002335283 5:178473400-178473422 CTCTGGAGGCTGAGGTAGGAGGG - Intronic
1002906292 6:1451905-1451927 TTTTTGATGGTGAGCAAGGAGGG + Intergenic
1003411303 6:5865205-5865227 CTGGGGATGGTGAGCATGGTAGG + Intergenic
1005529810 6:26691640-26691662 CTGGTGAGGGTGAGCTAGAAGGG - Intergenic
1005540986 6:26810007-26810029 CTGGTGAGGGTGAGCTAGAAGGG + Intergenic
1006020589 6:31115442-31115464 TTGGGGACGGTGATCTAGGAGGG + Exonic
1007599187 6:43071366-43071388 CTGTGGATGGTGAGTGGTGAGGG + Exonic
1007974538 6:46087025-46087047 ATGTGTATGGTGAGCTAGGATGG - Intergenic
1008519343 6:52348232-52348254 ATGTGGATGGTGGCATAGGAGGG + Intergenic
1009011801 6:57852096-57852118 CTGGTGAGGGTGAGCTAGAAGGG + Intergenic
1011773565 6:90702456-90702478 CTGAGGATGGTGACTTAGAAGGG + Intergenic
1012684322 6:102225407-102225429 ATGTAGATGGAGATCTAGGAGGG + Intergenic
1013338440 6:109189198-109189220 CTCTGGTTGGGGGGCTAGGAGGG + Intergenic
1015244267 6:131060285-131060307 CTGTGGCTGGTGAACTACAAAGG - Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1018135439 6:160774316-160774338 CTGTGCATAGTTAGCTACGATGG - Intergenic
1019057873 6:169236060-169236082 GTGTGGATGGTGAGTGTGGATGG - Intronic
1019194498 6:170273270-170273292 CTGTGGATGCTGAGCTTCCACGG + Intergenic
1020479937 7:8646917-8646939 CTGGGCATGGGGAGCTGGGAGGG + Intronic
1022260057 7:28695426-28695448 CTGGGGATGGTGGGGTGGGAGGG + Intronic
1022472155 7:30688629-30688651 CTGTGGATGCAGACCTGGGAAGG + Intronic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1026070076 7:67110895-67110917 CTGAGGATGCTGAGTTGGGAGGG + Intronic
1026706831 7:72701369-72701391 CTGAGGATGCTGAGTCAGGAGGG - Intronic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1028452864 7:91005215-91005237 CTGAGGCTGGTGAGCCAGCAGGG + Intronic
1032806740 7:135362810-135362832 CTGTGGGTGGTGGGCTGAGAGGG + Exonic
1033881299 7:145887149-145887171 GGATGGATGGTGAGCTAGAAAGG + Intergenic
1034203828 7:149298927-149298949 CTCTGGATTGTGCTCTAGGAAGG - Intergenic
1034395485 7:150821229-150821251 CGGTGGATGTTCAGCTAGGGTGG - Intergenic
1035396166 7:158536501-158536523 TTGTTGATGGTGGGCTGGGAAGG - Intronic
1036565585 8:9935257-9935279 CCTAGGATGGTGAGCTTGGAGGG + Intergenic
1036596487 8:10217582-10217604 CTGTGGAAGCTGAGCGAGCAAGG - Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1038343970 8:26714998-26715020 CTGGGGAGGGTGAGGTGGGAGGG + Intergenic
1039162992 8:34643451-34643473 CTGAGGATGGTGGGGTAGGTGGG + Intergenic
1039312135 8:36328193-36328215 CTGTAGATGGTGACGTAGTAGGG - Intergenic
1039391404 8:37183899-37183921 GTGTGGATGTTGTGCAAGGAAGG - Intergenic
1039963022 8:42264262-42264284 CTGGGGAGGCTGAGGTAGGAGGG - Intergenic
1040674070 8:49727686-49727708 CTAAGGGTAGTGAGCTAGGAGGG - Intergenic
1041700192 8:60780134-60780156 GTTTGGATGGTGAGCTATGAGGG + Intronic
1043060360 8:75492727-75492749 CTGTGTAAGGTCAGCTGGGATGG - Intronic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048962457 8:139591921-139591943 CTCAGGAAGGTGAGGTAGGAGGG + Intergenic
1049369528 8:142257257-142257279 CTTTGCATGCTCAGCTAGGAGGG - Intronic
1050538113 9:6647427-6647449 AGGCGGGTGGTGAGCTAGGACGG + Intergenic
1057556540 9:96092777-96092799 CACTGGATGGTGAGTTAAGAAGG - Intergenic
1058571197 9:106346887-106346909 CTCGGGAGGGTGAGGTAGGAGGG + Intergenic
1058643883 9:107112552-107112574 CTCTGGATGGTGAGTCATGAGGG - Intergenic
1059018075 9:110543770-110543792 CTGGGTTTGGTGGGCTAGGATGG + Intronic
1059098956 9:111450818-111450840 CTTGGGAGGGTGAGGTAGGAGGG + Intronic
1060509304 9:124220610-124220632 CTGTTGATGGTGAAATGGGAAGG - Intergenic
1060924467 9:127446431-127446453 CTTAGGATGCTGAGGTAGGAGGG - Intergenic
1061691840 9:132339330-132339352 CTGGGCATGGTGACCGAGGAAGG + Intronic
1062707833 9:137954980-137955002 CTGGGGATGCTGAGCTGGAAGGG + Intronic
1203784032 EBV:117209-117231 CTGTCCATGGTGATGTAGGACGG - Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187306345 X:18098758-18098780 AAGTGGGTGGTGATCTAGGAAGG + Intergenic
1187468679 X:19548872-19548894 TTGTGGAAGGTGAGCTTGGAGGG + Intronic
1189537969 X:41956085-41956107 CTGTGGATGGGGAGCTTGAGTGG - Intergenic
1190709275 X:53054714-53054736 ATCTGGATGGTGAGATAGGGTGG + Intronic
1191767416 X:64713444-64713466 CTGGGGGTGGTGTGCTAGGCTGG - Intergenic
1194635544 X:96342126-96342148 CTGTGGATGGAGACCCCGGATGG + Intergenic
1196111715 X:111953609-111953631 CTCTGGAGGCTGAGTTAGGATGG + Intronic