ID: 1018027524

View in Genome Browser
Species Human (GRCh38)
Location 6:159817652-159817674
Sequence GCCTACGTGCCCAGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018027524_1018027528 22 Left 1018027524 6:159817652-159817674 CCTGCAGCCCTGGGCACGTAGGC 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018027524 Original CRISPR GCCTACGTGCCCAGGGCTGC AGG (reversed) Intronic
900138187 1:1127652-1127674 GCCTAGGTGGCCAGGTCTGGGGG + Intergenic
900204078 1:1424208-1424230 GCCACCGTGCCCAGCGCTGTAGG + Intergenic
900497395 1:2982240-2982262 GGCTATGTCCCGAGGGCTGCAGG + Intergenic
900501315 1:3006103-3006125 CCCTACCTGCCCAGGGTTGAAGG - Intergenic
902708244 1:18221323-18221345 CCCTATCTGCCCAGGGCTGAGGG - Intronic
903646333 1:24898321-24898343 GCCTGAGGTCCCAGGGCTGCGGG - Intergenic
903768860 1:25751559-25751581 GCCTGCCTGCCCAGGGGTTCTGG - Intronic
903856852 1:26342921-26342943 GAGGATGTGCCCAGGGCTGCTGG + Intronic
903950697 1:26994363-26994385 GGCTGCGTGCCCTGGGGTGCCGG + Exonic
906169032 1:43707974-43707996 GCCAAGGTGCGCAGCGCTGCGGG - Intronic
906518480 1:46453411-46453433 GCCTGCCTGCCCTGGGCTGCAGG + Intergenic
908186049 1:61654316-61654338 GCCTCGGCGCCCAGGTCTGCGGG - Intergenic
914525167 1:148459170-148459192 GCTTACGAGCGCAGGGCAGCAGG + Intergenic
915428793 1:155849257-155849279 GCCACCGTGCCCAGCCCTGCTGG - Intronic
920682590 1:208084245-208084267 GCCCACATCCCCAGGGATGCAGG - Intronic
922097083 1:222451809-222451831 CCCTACCTGCCCAGAGCAGCAGG + Intergenic
923558124 1:235017828-235017850 GCCTATGTGCCTAGAGCTCCTGG - Intergenic
1062840527 10:666784-666806 GCCTACTTCCCCAGGCCTACGGG + Intronic
1065687752 10:28302911-28302933 GCCTCCGGGCCCGGGGCTGCAGG - Intronic
1065846314 10:29746600-29746622 GCCCATGTTGCCAGGGCTGCAGG + Intergenic
1066967389 10:42281880-42281902 CCCCACGTGACCAGGCCTGCTGG - Intergenic
1067790118 10:49281563-49281585 GCCCCAGTGCCCAGGCCTGCAGG + Intergenic
1070526581 10:77300746-77300768 ACCTACATCCCCAGGGGTGCTGG - Intronic
1070844327 10:79509568-79509590 GCTTAAGGGCCAAGGGCTGCAGG - Intergenic
1070929470 10:80250740-80250762 GCTTAAGGGCCAAGGGCTGCAGG + Intergenic
1073441278 10:103554144-103554166 GCATGCCTGCCCAGGGCTGGAGG + Intronic
1076846771 10:133073106-133073128 AGCTGGGTGCCCAGGGCTGCTGG + Intronic
1077394604 11:2314924-2314946 GGCTCTGTGCCAAGGGCTGCAGG + Intronic
1078386819 11:10899645-10899667 GCTTACATGCTCAGGCCTGCAGG + Intergenic
1079220787 11:18559158-18559180 GCCACCGTGCCCAGGTCTGCAGG + Intronic
1080791524 11:35525947-35525969 GCAGAGGTACCCAGGGCTGCGGG + Intronic
1081585421 11:44380598-44380620 CCCAACGTGCCCACAGCTGCTGG - Intergenic
1082976351 11:59076650-59076672 GCCTAGGGTCCCAGGGCTGGAGG + Intergenic
1083277283 11:61603905-61603927 GCCTCCCAGCCCTGGGCTGCTGG - Intergenic
1083675698 11:64323567-64323589 GCCTCCCTGCCCAGGGTTGCAGG + Intergenic
1084175475 11:67420344-67420366 GCCCAGGCCCCCAGGGCTGCAGG + Intronic
1084558713 11:69890667-69890689 GCCTGCCTGCCAAGGGGTGCTGG + Intergenic
1089899645 11:121967278-121967300 ACCTACGTGCCCAGGGTCGGAGG + Intergenic
1090350589 11:126105363-126105385 GCCCATGTGCCCAATGCTGCCGG - Intergenic
1093762841 12:22929564-22929586 GCTTACATGTCCAGTGCTGCTGG + Intergenic
1096198848 12:49666674-49666696 GCCTAAGTAGCCAGGGCTACAGG - Intronic
1096215790 12:49796817-49796839 GCCTTCCTGGCCGGGGCTGCAGG - Exonic
1096240320 12:49956306-49956328 GCCTTGGGGCCCAGCGCTGCAGG - Exonic
1098665859 12:73162384-73162406 GCCTATGTGCCCAAGGTTGTCGG - Intergenic
1099955736 12:89351584-89351606 GGCTAGGGGCGCAGGGCTGCGGG - Intronic
1103918265 12:124386911-124386933 GCCCACTTTCCCAGGGCTGTGGG + Intronic
1105335129 13:19460178-19460200 GCCCATGTCACCAGGGCTGCGGG - Intronic
1113453493 13:110430552-110430574 TCCCACATGCCCAGGGCGGCCGG - Exonic
1113741700 13:112715999-112716021 GCCAGCCTGCCCAGAGCTGCTGG - Intronic
1114526915 14:23372252-23372274 GCCTACCCTCACAGGGCTGCTGG - Intergenic
1121996695 14:98608334-98608356 CCCACCGTGCACAGGGCTGCTGG - Intergenic
1122815409 14:104309726-104309748 CCCTACCTGCCCAGTGCTCCTGG + Intergenic
1124179460 15:27458853-27458875 TCCTACATGCCCAGGGCCACAGG - Intronic
1124961207 15:34397027-34397049 GCCCAGGAGGCCAGGGCTGCAGG - Intronic
1124977837 15:34543248-34543270 GCCCAGGAGGCCAGGGCTGCAGG - Intronic
1125506110 15:40268535-40268557 GCCCCAGTGCCAAGGGCTGCTGG - Intronic
1126421067 15:48472565-48472587 GGCTTCGTGCCCAGTGCTGACGG - Exonic
1129713712 15:77834807-77834829 GCCTGTGTTCCCTGGGCTGCAGG - Intergenic
1132365373 15:101252471-101252493 GCGCACGTCCCCAGGGCTCCGGG - Intergenic
1136277389 16:29187044-29187066 ACCAACCTGCCCAGGGCAGCAGG - Intergenic
1136419422 16:30122832-30122854 GCCTACGTCCTCAGGGGAGCAGG - Intronic
1136932923 16:34435329-34435351 GCTGAGGGGCCCAGGGCTGCTGG - Intergenic
1136971649 16:34976485-34976507 GCTGAGGGGCCCAGGGCTGCTGG + Intergenic
1138590776 16:57998637-57998659 GCAGAGGTGCTCAGGGCTGCAGG + Intronic
1140034048 16:71359434-71359456 ACCTACATGCCCACGGCGGCTGG - Intronic
1142081765 16:88153087-88153109 GCCAACCTGCCCGGGGCAGCAGG - Intergenic
1142340661 16:89520196-89520218 GCCTGCGCACCCAGGGCTGCAGG - Intronic
1142617317 17:1143828-1143850 GCTTCTCTGCCCAGGGCTGCTGG - Intronic
1143145139 17:4770351-4770373 GCCCAGGTGGTCAGGGCTGCAGG + Intergenic
1143513154 17:7406722-7406744 GCCTGGGTGCTCAGGGCAGCAGG - Intronic
1145248678 17:21285595-21285617 TCCTGGGAGCCCAGGGCTGCAGG - Intronic
1150798000 17:68254940-68254962 GCCTTCCTGCCCTGGGCTCCAGG + Intronic
1151162990 17:72181484-72181506 GCCCAGGTGCCAAGGGCAGCAGG - Intergenic
1152407752 17:80107376-80107398 GCCAGGGTGCCAAGGGCTGCAGG + Intergenic
1152432089 17:80254127-80254149 GCCTCTGTAACCAGGGCTGCTGG + Intergenic
1152461445 17:80444432-80444454 GCCCAAGTCCCCAGGGCTCCAGG + Intergenic
1152924936 17:83082782-83082804 GACTTCGTGCCGAGGTCTGCTGG + Intronic
1153963734 18:10161660-10161682 ACCCACGTGCTCAGGGCAGCGGG + Intergenic
1157591333 18:48837857-48837879 ACCCAGTTGCCCAGGGCTGCTGG - Intronic
1158617867 18:59004612-59004634 GCCTCCTGGCCTAGGGCTGCTGG + Intergenic
1160715717 19:575687-575709 GCCTCCTTGCCCAGGGCTCAGGG - Intronic
1161124123 19:2546416-2546438 GCCGTGGGGCCCAGGGCTGCGGG + Intronic
1165421285 19:35723187-35723209 GCCTACGTGTGCAGGACTGTGGG + Exonic
1166214791 19:41327859-41327881 GCCCACCTGCCCAGGGCTGCCGG - Intronic
1167147740 19:47693409-47693431 GCCTGTGTGTCCATGGCTGCAGG - Intronic
1167148268 19:47695095-47695117 GCCTATGTGCCCAGGGAGACGGG + Intronic
1167688015 19:50968689-50968711 GCCGCAGAGCCCAGGGCTGCAGG + Exonic
1168189220 19:54725924-54725946 ACCTGGGTGCCCAGGGCTACAGG - Intronic
1168191235 19:54740139-54740161 ACCTTGGTGCCCAGGGCTGAAGG - Intronic
1168201379 19:54818186-54818208 ACCTGGGTGCCCAGGGCTACAGG - Intronic
1168206115 19:54851870-54851892 ACCTGGGTGCCCAGGGCTACAGG - Intronic
925362436 2:3288909-3288931 GCCCAGGGGGCCAGGGCTGCTGG - Intronic
925740568 2:7002283-7002305 ACCTACGTACCCAGGGCATCTGG - Intronic
926695278 2:15766474-15766496 GCCGACCTGCCCAGGGCGGAAGG - Intergenic
927575908 2:24201633-24201655 TCCTGTGTTCCCAGGGCTGCGGG - Intergenic
928346023 2:30496784-30496806 ACGTACCTGCCCAGGGATGCGGG + Intronic
929095606 2:38260719-38260741 CCGTAGGTGCCCAGGGCTGGCGG - Intergenic
930096302 2:47569626-47569648 GAATACGTGCCAAGGGCTACCGG - Intronic
931246693 2:60498208-60498230 ACTTCTGTGCCCAGGGCTGCTGG - Intronic
932158243 2:69437563-69437585 GCCTACGCGCCGAGGTTTGCAGG + Exonic
932454971 2:71843720-71843742 TCCTCCAGGCCCAGGGCTGCTGG - Intergenic
934523416 2:95033888-95033910 GCCCACGTTCCCACAGCTGCCGG - Intronic
935258024 2:101329920-101329942 GCATAAATGACCAGGGCTGCTGG + Intergenic
938196296 2:129331761-129331783 GCCTAAGAGCCCAGGGTTACCGG + Intergenic
942292501 2:174486774-174486796 GCCCACGTGCCCAGGCCTGAGGG + Intronic
944461660 2:199955992-199956014 CGCTACCTGCCCAGGGCTCCCGG + Exonic
947700787 2:232232281-232232303 GGCTGCGTGCTCAGGGCAGCAGG + Intronic
948116132 2:235495118-235495140 GCCTCCGCGTCCTGGGCTGCCGG + Intronic
1172007837 20:31829691-31829713 GCCCATGTGGCCAGGGCTTCCGG + Intronic
1172587964 20:36098031-36098053 GCCTCTGTGCCCAGGTCTCCAGG - Intronic
1173159468 20:40641547-40641569 ACCTAACTGCCCAGGGATGCTGG - Intergenic
1173793627 20:45843735-45843757 GCCCAGGAGCCCAGGGCTGATGG - Intronic
1176703275 21:10084897-10084919 GCCACCATACCCAGGGCTGCAGG + Intergenic
1177787887 21:25692045-25692067 GCCTCAGTGGCCAGGCCTGCTGG + Intronic
1179481487 21:41681528-41681550 TCCAGCGTGCCCAGGGCAGCTGG + Intergenic
1179627735 21:42658117-42658139 GGCTCCGTGCCCTGGGCAGCTGG + Intronic
1179642563 21:42757066-42757088 GCCTCGCTGCCCAGAGCTGCTGG - Intronic
1180092548 21:45540408-45540430 GCCCAAGTACCCAGGGCTCCCGG - Intronic
1181051066 22:20238557-20238579 ACCTGTCTGCCCAGGGCTGCAGG - Intergenic
1181731301 22:24848855-24848877 CCCTGCCTGCCCAGGGCTGCTGG + Intronic
1182228873 22:28821234-28821256 GCCTGTGTGCCCAGGACTGAGGG + Intergenic
1183381058 22:37490770-37490792 GACCTCGTGCCCAGGGCAGCGGG + Exonic
950008013 3:9703946-9703968 GGCTGCGAGACCAGGGCTGCTGG - Exonic
954133925 3:48573380-48573402 GCCCACGTGGCCAGGGCTCCTGG + Intronic
954440034 3:50516759-50516781 GTCTAAGTCCCCAGGGCTGAGGG + Intergenic
961040526 3:123675076-123675098 GCATCAGTGCCCAGGGCTGGGGG - Intronic
961644502 3:128385386-128385408 GCCTGCATTCCCAGGGCAGCAGG - Intronic
966726688 3:183115090-183115112 ACCAACGTGCCCAGGGATGCCGG + Intronic
966908345 3:184543752-184543774 TCACAGGTGCCCAGGGCTGCAGG + Intronic
967378487 3:188831570-188831592 GCCTGGGTGGCCAGGCCTGCAGG - Intronic
968908230 4:3464136-3464158 CCCTACAGGCCCAGCGCTGCAGG - Intronic
969186569 4:5478946-5478968 GCCTAGGTGCCCATGCCTGTGGG - Intronic
969697847 4:8745243-8745265 GCGTCGGTGCCCAGGGATGCTGG - Intergenic
970523416 4:16908187-16908209 GCCAACCTGCCCCGGGCTGGGGG - Intergenic
971479537 4:27102037-27102059 GCCTGCTGGCTCAGGGCTGCAGG - Intergenic
977607192 4:98995479-98995501 GCCTGCGTGCCCAAGCCTCCCGG - Intergenic
982315198 4:154024572-154024594 GCCTATGGGCCCAGCTCTGCGGG - Intergenic
985075421 4:186209233-186209255 GCCTACGTGCCCTTCTCTGCTGG + Exonic
985627972 5:999940-999962 GCCGAGGAGCCCTGGGCTGCAGG + Intergenic
986035519 5:3933409-3933431 GCCTGAGTTCCCTGGGCTGCTGG - Intergenic
991017103 5:61944016-61944038 GACTGTGTGCCCAGGGATGCTGG - Intergenic
993992700 5:94679513-94679535 GCCCAGGAGTCCAGGGCTGCAGG + Intronic
994251528 5:97542132-97542154 CCCTCAGTGCCCAGGGCGGCGGG + Intergenic
997877433 5:137561765-137561787 GCCTATTAACCCAGGGCTGCAGG - Intronic
1002172998 5:177385829-177385851 GCCTACGTGCCCAGCCCTCAGGG + Exonic
1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG + Intergenic
1003672349 6:8171045-8171067 GCCTCCGTGCCCAGGTCCACAGG - Intergenic
1004081099 6:12394055-12394077 GACTTAGTGCACAGGGCTGCTGG + Intergenic
1006168400 6:32079311-32079333 GCCTCCGTGCCCAGTTCTGTGGG + Intronic
1006301082 6:33193755-33193777 TGCTATGTGCCCAGGGCTGGAGG + Exonic
1007605355 6:43114028-43114050 CCCTGCGGCCCCAGGGCTGCTGG + Intronic
1014055879 6:117014864-117014886 CCCTAATTGCCCAGGGCTGCAGG - Intergenic
1016641275 6:146352352-146352374 GCCCACGTGGCCAGGGCAGAGGG - Exonic
1017291531 6:152743993-152744015 CCCTGCGTCTCCAGGGCTGCTGG - Intergenic
1017946946 6:159103814-159103836 CCCTAAGTGCACAGCGCTGCAGG + Intergenic
1018027524 6:159817652-159817674 GCCTACGTGCCCAGGGCTGCAGG - Intronic
1019033758 6:169036344-169036366 GCCTGAGTGCTCAAGGCTGCCGG - Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1026216387 7:68353211-68353233 CCTTACCTTCCCAGGGCTGCTGG + Intergenic
1026898020 7:74021791-74021813 CCCTCCGTTCCCAGGACTGCAGG + Intergenic
1027122712 7:75533413-75533435 GCCTACCTTCCCAGGGCAGGTGG - Exonic
1027865719 7:83643812-83643834 GCCTATGTGCCCAGAGCTTCAGG - Intronic
1028912978 7:96228816-96228838 CCCTCAGTGCCCAGGGCTGGCGG - Intronic
1029253129 7:99251027-99251049 GCCTGGGAGCCCAGGGCTGAGGG - Intergenic
1034023237 7:147668814-147668836 GCCTAAGTGTCCAGTGCTTCTGG + Intronic
1034275470 7:149822010-149822032 GCAGCCTTGCCCAGGGCTGCTGG + Intergenic
1035420209 7:158723580-158723602 GCCTGCGAGCCCAGGCCTGTAGG - Intergenic
1035552934 8:544385-544407 GCTTAACTGGCCAGGGCTGCCGG - Intronic
1041030403 8:53730606-53730628 GCCCACGTATTCAGGGCTGCAGG + Intronic
1041639301 8:60179451-60179473 GGCTAAGAGCCCTGGGCTGCTGG - Intergenic
1048524762 8:135192197-135192219 TCCTACTTGCCCAGGACTGAGGG - Intergenic
1049198936 8:141330536-141330558 GGGTCCCTGCCCAGGGCTGCCGG + Intergenic
1049561813 8:143315895-143315917 CCCTACGTGCCCACCGCAGCTGG + Intronic
1049692653 8:143969404-143969426 GCCTCCGTGCTGAGGGCTGTGGG + Intronic
1049692977 8:143970893-143970915 GCCTCCGTGCTGAGGGCTGTGGG - Intronic
1053183169 9:35991853-35991875 ACTTATGTGCCCATGGCTGCTGG - Intergenic
1053185602 9:36013594-36013616 GCCTACATGCCCATGGCTGTTGG + Intergenic
1053640539 9:40071931-40071953 GCCACCATACCCAGGGCTGCAGG + Intergenic
1053765599 9:41393542-41393564 GCCACCATACCCAGGGCTGCAGG - Intergenic
1054321230 9:63667929-63667951 GCCACCATACCCAGGGCTGCAGG + Intergenic
1054544211 9:66304696-66304718 GCCACCATACCCAGGGCTGCAGG - Intergenic
1056968162 9:91180936-91180958 GCCTGCCTGCCCACGGCTCCTGG - Intergenic
1057180873 9:93029491-93029513 GCCCCCGTCCCCAGGGCTGCAGG + Intronic
1058397349 9:104569585-104569607 GCCTATGTGGCCATGGCAGCTGG + Exonic
1058399567 9:104598974-104598996 GCCTATGTACCCATGGCAGCTGG - Exonic
1058400030 9:104605188-104605210 GCCTATGTACCCATGGCAGCTGG - Exonic
1058400863 9:104617765-104617787 GCCTATGTACCCATGGCTGTTGG - Exonic
1059414392 9:114154277-114154299 GCCCCCGCGCCCACGGCTGCGGG + Intergenic
1060969355 9:127729492-127729514 ACCGAGGGGCCCAGGGCTGCTGG + Intronic
1061527552 9:131179358-131179380 GCGAACCTGCCCAGGGCAGCGGG - Intronic
1061573908 9:131494508-131494530 GCCTAAGTGTCCAGGGCTGAAGG - Intronic
1061956214 9:133962505-133962527 GCCCAGGTGCCCTGGGCTGGGGG - Intronic
1062023405 9:134329630-134329652 GCCCGCGTGACCAGGGCTGCCGG - Intronic
1062330973 9:136044842-136044864 ACCCAGGTGGCCAGGGCTGCTGG - Intronic
1062344320 9:136107927-136107949 GCCTACCTGTCCAGGGGTGGGGG - Intergenic
1062637109 9:137497330-137497352 GGCTGGGGGCCCAGGGCTGCAGG - Intronic
1202788307 9_KI270719v1_random:55004-55026 GCCACCATACCCAGGGCTGCAGG + Intergenic