ID: 1018027524

View in Genome Browser
Species Human (GRCh38)
Location 6:159817652-159817674
Sequence GCCTACGTGCCCAGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018027524_1018027528 22 Left 1018027524 6:159817652-159817674 CCTGCAGCCCTGGGCACGTAGGC 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018027524 Original CRISPR GCCTACGTGCCCAGGGCTGC AGG (reversed) Intronic