ID: 1018027528

View in Genome Browser
Species Human (GRCh38)
Location 6:159817697-159817719
Sequence GCACGCTACAGCACCGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018027525_1018027528 15 Left 1018027525 6:159817659-159817681 CCCTGGGCACGTAGGCACCAGAA 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data
1018027526_1018027528 14 Left 1018027526 6:159817660-159817682 CCTGGGCACGTAGGCACCAGAAA 0: 1
1: 0
2: 0
3: 22
4: 593
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data
1018027524_1018027528 22 Left 1018027524 6:159817652-159817674 CCTGCAGCCCTGGGCACGTAGGC 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data
1018027527_1018027528 -2 Left 1018027527 6:159817676-159817698 CCAGAAACACATTAGCAGCGTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1018027528 6:159817697-159817719 GCACGCTACAGCACCGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018027528 Original CRISPR GCACGCTACAGCACCGTCCT TGG Intronic