ID: 1018028433

View in Genome Browser
Species Human (GRCh38)
Location 6:159823205-159823227
Sequence CAGAATCCACAGAAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028433_1018028439 12 Left 1018028433 6:159823205-159823227 CCAAGCTCCTTCTGTGGATTCTG No data
Right 1018028439 6:159823240-159823262 AAGCCCTTTCTCTCTGTATTTGG No data
1018028433_1018028440 13 Left 1018028433 6:159823205-159823227 CCAAGCTCCTTCTGTGGATTCTG No data
Right 1018028440 6:159823241-159823263 AGCCCTTTCTCTCTGTATTTGGG No data
1018028433_1018028441 14 Left 1018028433 6:159823205-159823227 CCAAGCTCCTTCTGTGGATTCTG No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028433 Original CRISPR CAGAATCCACAGAAGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr