ID: 1018028441

View in Genome Browser
Species Human (GRCh38)
Location 6:159823242-159823264
Sequence GCCCTTTCTCTCTGTATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028435_1018028441 -9 Left 1018028435 6:159823228-159823250 CCCCAAGTCCACAAGCCCTTTCT No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data
1018028434_1018028441 7 Left 1018028434 6:159823212-159823234 CCTTCTGTGGATTCTGCCCCAAG No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data
1018028431_1018028441 19 Left 1018028431 6:159823200-159823222 CCTGCCCAAGCTCCTTCTGTGGA No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data
1018028436_1018028441 -10 Left 1018028436 6:159823229-159823251 CCCAAGTCCACAAGCCCTTTCTC No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data
1018028433_1018028441 14 Left 1018028433 6:159823205-159823227 CCAAGCTCCTTCTGTGGATTCTG No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data
1018028432_1018028441 15 Left 1018028432 6:159823204-159823226 CCCAAGCTCCTTCTGTGGATTCT No data
Right 1018028441 6:159823242-159823264 GCCCTTTCTCTCTGTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028441 Original CRISPR GCCCTTTCTCTCTGTATTTG GGG Intergenic
No off target data available for this crispr