ID: 1018028826

View in Genome Browser
Species Human (GRCh38)
Location 6:159826262-159826284
Sequence GAAGGCACACTGGGGAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028826_1018028838 25 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028838 6:159826310-159826332 CGGGGTGCCTCCTGCTCATGTGG No data
1018028826_1018028836 7 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028836 6:159826292-159826314 TGCAGCTTCTCTCCAGAGCGGGG No data
1018028826_1018028839 26 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028839 6:159826311-159826333 GGGGTGCCTCCTGCTCATGTGGG No data
1018028826_1018028834 5 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028826_1018028840 30 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028826_1018028835 6 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028835 6:159826291-159826313 ATGCAGCTTCTCTCCAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028826 Original CRISPR GAAGGCACACTGGGGAGTTA GGG (reversed) Intergenic
No off target data available for this crispr