ID: 1018028827

View in Genome Browser
Species Human (GRCh38)
Location 6:159826263-159826285
Sequence GGAAGGCACACTGGGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028827_1018028840 29 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028827_1018028835 5 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028835 6:159826291-159826313 ATGCAGCTTCTCTCCAGAGCGGG No data
1018028827_1018028839 25 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028839 6:159826311-159826333 GGGGTGCCTCCTGCTCATGTGGG No data
1018028827_1018028836 6 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028836 6:159826292-159826314 TGCAGCTTCTCTCCAGAGCGGGG No data
1018028827_1018028834 4 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028827_1018028838 24 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028838 6:159826310-159826332 CGGGGTGCCTCCTGCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028827 Original CRISPR GGAAGGCACACTGGGGAGTT AGG (reversed) Intergenic