ID: 1018028831

View in Genome Browser
Species Human (GRCh38)
Location 6:159826280-159826302
Sequence GAGAAGCTGCATTGTAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028831_1018028843 26 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028831_1018028840 12 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028831_1018028844 27 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028844 6:159826330-159826352 TGGGCTGGCAGCACCACTGAGGG No data
1018028831_1018028838 7 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028838 6:159826310-159826332 CGGGGTGCCTCCTGCTCATGTGG No data
1018028831_1018028839 8 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028839 6:159826311-159826333 GGGGTGCCTCCTGCTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028831 Original CRISPR GAGAAGCTGCATTGTAGGGA AGG (reversed) Intergenic
No off target data available for this crispr