ID: 1018028832

View in Genome Browser
Species Human (GRCh38)
Location 6:159826284-159826306
Sequence TGGAGAGAAGCTGCATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028832_1018028838 3 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028838 6:159826310-159826332 CGGGGTGCCTCCTGCTCATGTGG No data
1018028832_1018028847 30 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028847 6:159826337-159826359 GCAGCACCACTGAGGGCCTGGGG No data
1018028832_1018028845 28 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028832_1018028839 4 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028839 6:159826311-159826333 GGGGTGCCTCCTGCTCATGTGGG No data
1018028832_1018028840 8 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028832_1018028846 29 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028832_1018028843 22 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028832_1018028844 23 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028844 6:159826330-159826352 TGGGCTGGCAGCACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028832 Original CRISPR TGGAGAGAAGCTGCATTGTA GGG (reversed) Intergenic