ID: 1018028834

View in Genome Browser
Species Human (GRCh38)
Location 6:159826290-159826312
Sequence AATGCAGCTTCTCTCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028828_1018028834 -3 Left 1018028828 6:159826270-159826292 CCCCAGTGTGCCTTCCCTACAAT No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028830_1018028834 -5 Left 1018028830 6:159826272-159826294 CCAGTGTGCCTTCCCTACAATGC No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028826_1018028834 5 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028827_1018028834 4 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data
1018028829_1018028834 -4 Left 1018028829 6:159826271-159826293 CCCAGTGTGCCTTCCCTACAATG No data
Right 1018028834 6:159826290-159826312 AATGCAGCTTCTCTCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028834 Original CRISPR AATGCAGCTTCTCTCCAGAG CGG Intergenic
No off target data available for this crispr