ID: 1018028837

View in Genome Browser
Species Human (GRCh38)
Location 6:159826304-159826326
Sequence GAGCAGGAGGCACCCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028837_1018028848 14 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028848 6:159826341-159826363 CACCACTGAGGGCCTGGGGCTGG No data
1018028837_1018028847 10 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028847 6:159826337-159826359 GCAGCACCACTGAGGGCCTGGGG No data
1018028837_1018028845 8 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028837_1018028843 2 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028837_1018028844 3 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028844 6:159826330-159826352 TGGGCTGGCAGCACCACTGAGGG No data
1018028837_1018028846 9 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028837 Original CRISPR GAGCAGGAGGCACCCCGCTC TGG (reversed) Intergenic
No off target data available for this crispr