ID: 1018028840

View in Genome Browser
Species Human (GRCh38)
Location 6:159826315-159826337
Sequence TGCCTCCTGCTCATGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028827_1018028840 29 Left 1018028827 6:159826263-159826285 CCTAACTCCCCAGTGTGCCTTCC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028833_1018028840 7 Left 1018028833 6:159826285-159826307 CCTACAATGCAGCTTCTCTCCAG No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028826_1018028840 30 Left 1018028826 6:159826262-159826284 CCCTAACTCCCCAGTGTGCCTTC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028829_1018028840 21 Left 1018028829 6:159826271-159826293 CCCAGTGTGCCTTCCCTACAATG No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028828_1018028840 22 Left 1018028828 6:159826270-159826292 CCCCAGTGTGCCTTCCCTACAAT No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028832_1018028840 8 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028830_1018028840 20 Left 1018028830 6:159826272-159826294 CCAGTGTGCCTTCCCTACAATGC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data
1018028831_1018028840 12 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028840 6:159826315-159826337 TGCCTCCTGCTCATGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028840 Original CRISPR TGCCTCCTGCTCATGTGGGC TGG Intergenic
No off target data available for this crispr