ID: 1018028841

View in Genome Browser
Species Human (GRCh38)
Location 6:159826317-159826339
Sequence TGCCAGCCCACATGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028841_1018028846 -4 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028841_1018028848 1 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028848 6:159826341-159826363 CACCACTGAGGGCCTGGGGCTGG No data
1018028841_1018028854 28 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028854 6:159826368-159826390 GTCCCTGCCCACTGTCTAGTGGG No data
1018028841_1018028847 -3 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028847 6:159826337-159826359 GCAGCACCACTGAGGGCCTGGGG No data
1018028841_1018028845 -5 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028841_1018028855 29 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028855 6:159826369-159826391 TCCCTGCCCACTGTCTAGTGGGG No data
1018028841_1018028844 -10 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028844 6:159826330-159826352 TGGGCTGGCAGCACCACTGAGGG No data
1018028841_1018028853 27 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028853 6:159826367-159826389 AGTCCCTGCCCACTGTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028841 Original CRISPR TGCCAGCCCACATGAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr