ID: 1018028843

View in Genome Browser
Species Human (GRCh38)
Location 6:159826329-159826351
Sequence GTGGGCTGGCAGCACCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028833_1018028843 21 Left 1018028833 6:159826285-159826307 CCTACAATGCAGCTTCTCTCCAG No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028832_1018028843 22 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028837_1018028843 2 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data
1018028831_1018028843 26 Left 1018028831 6:159826280-159826302 CCTTCCCTACAATGCAGCTTCTC No data
Right 1018028843 6:159826329-159826351 GTGGGCTGGCAGCACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028843 Original CRISPR GTGGGCTGGCAGCACCACTG AGG Intergenic
No off target data available for this crispr