ID: 1018028845

View in Genome Browser
Species Human (GRCh38)
Location 6:159826335-159826357
Sequence TGGCAGCACCACTGAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028832_1018028845 28 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028842_1018028845 -8 Left 1018028842 6:159826320-159826342 CCTGCTCATGTGGGCTGGCAGCA No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028837_1018028845 8 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028833_1018028845 27 Left 1018028833 6:159826285-159826307 CCTACAATGCAGCTTCTCTCCAG No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data
1018028841_1018028845 -5 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028845 6:159826335-159826357 TGGCAGCACCACTGAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028845 Original CRISPR TGGCAGCACCACTGAGGGCC TGG Intergenic
No off target data available for this crispr