ID: 1018028846

View in Genome Browser
Species Human (GRCh38)
Location 6:159826336-159826358
Sequence GGCAGCACCACTGAGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018028832_1018028846 29 Left 1018028832 6:159826284-159826306 CCCTACAATGCAGCTTCTCTCCA No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028837_1018028846 9 Left 1018028837 6:159826304-159826326 CCAGAGCGGGGTGCCTCCTGCTC No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028842_1018028846 -7 Left 1018028842 6:159826320-159826342 CCTGCTCATGTGGGCTGGCAGCA No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028841_1018028846 -4 Left 1018028841 6:159826317-159826339 CCTCCTGCTCATGTGGGCTGGCA No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data
1018028833_1018028846 28 Left 1018028833 6:159826285-159826307 CCTACAATGCAGCTTCTCTCCAG No data
Right 1018028846 6:159826336-159826358 GGCAGCACCACTGAGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018028846 Original CRISPR GGCAGCACCACTGAGGGCCT GGG Intergenic
No off target data available for this crispr