ID: 1018030036

View in Genome Browser
Species Human (GRCh38)
Location 6:159834359-159834381
Sequence CATTTCCTGTGGCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018030020_1018030036 0 Left 1018030020 6:159834336-159834358 CCCACCCCTCCCTCACCCCCCAC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030017_1018030036 3 Left 1018030017 6:159834333-159834355 CCCCCCACCCCTCCCTCACCCCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030016_1018030036 6 Left 1018030016 6:159834330-159834352 CCGCCCCCCACCCCTCCCTCACC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030012_1018030036 17 Left 1018030012 6:159834319-159834341 CCTCCCCACTGCCGCCCCCCACC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030010_1018030036 21 Left 1018030010 6:159834315-159834337 CCCTCCTCCCCACTGCCGCCCCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030022_1018030036 -4 Left 1018030022 6:159834340-159834362 CCCCTCCCTCACCCCCCACCATT No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030015_1018030036 12 Left 1018030015 6:159834324-159834346 CCACTGCCGCCCCCCACCCCTCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030026_1018030036 -10 Left 1018030026 6:159834346-159834368 CCTCACCCCCCACCATTTCCTGT No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030021_1018030036 -1 Left 1018030021 6:159834337-159834359 CCACCCCTCCCTCACCCCCCACC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030014_1018030036 13 Left 1018030014 6:159834323-159834345 CCCACTGCCGCCCCCCACCCCTC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030011_1018030036 20 Left 1018030011 6:159834316-159834338 CCTCCTCCCCACTGCCGCCCCCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030013_1018030036 14 Left 1018030013 6:159834322-159834344 CCCCACTGCCGCCCCCCACCCCT No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030009_1018030036 22 Left 1018030009 6:159834314-159834336 CCCCTCCTCCCCACTGCCGCCCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030025_1018030036 -9 Left 1018030025 6:159834345-159834367 CCCTCACCCCCCACCATTTCCTG No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030023_1018030036 -5 Left 1018030023 6:159834341-159834363 CCCTCCCTCACCCCCCACCATTT No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030019_1018030036 1 Left 1018030019 6:159834335-159834357 CCCCACCCCTCCCTCACCCCCCA No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030024_1018030036 -6 Left 1018030024 6:159834342-159834364 CCTCCCTCACCCCCCACCATTTC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data
1018030018_1018030036 2 Left 1018030018 6:159834334-159834356 CCCCCACCCCTCCCTCACCCCCC No data
Right 1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018030036 Original CRISPR CATTTCCTGTGGCAGGTGGA AGG Intergenic
No off target data available for this crispr