ID: 1018033168

View in Genome Browser
Species Human (GRCh38)
Location 6:159860036-159860058
Sequence TCCCTAGGTGGGGTGGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018033168_1018033179 21 Left 1018033168 6:159860036-159860058 CCGACCCCCACCCCACCTAGGGA No data
Right 1018033179 6:159860080-159860102 ATTTTTGATTGTCCTGACTAGGG No data
1018033168_1018033178 20 Left 1018033168 6:159860036-159860058 CCGACCCCCACCCCACCTAGGGA No data
Right 1018033178 6:159860079-159860101 CATTTTTGATTGTCCTGACTAGG No data
1018033168_1018033181 28 Left 1018033168 6:159860036-159860058 CCGACCCCCACCCCACCTAGGGA No data
Right 1018033181 6:159860087-159860109 ATTGTCCTGACTAGGGAGGAAGG No data
1018033168_1018033180 24 Left 1018033168 6:159860036-159860058 CCGACCCCCACCCCACCTAGGGA No data
Right 1018033180 6:159860083-159860105 TTTGATTGTCCTGACTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018033168 Original CRISPR TCCCTAGGTGGGGTGGGGGT CGG (reversed) Intergenic