ID: 1018033860

View in Genome Browser
Species Human (GRCh38)
Location 6:159865619-159865641
Sequence CACTGGGCAAGGAGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018033849_1018033860 19 Left 1018033849 6:159865577-159865599 CCCGTTTATTATGGAGAATACAA No data
Right 1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG No data
1018033850_1018033860 18 Left 1018033850 6:159865578-159865600 CCGTTTATTATGGAGAATACAAC No data
Right 1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018033860 Original CRISPR CACTGGGCAAGGAGGGGAAA GGG Intergenic
No off target data available for this crispr