ID: 1018038331

View in Genome Browser
Species Human (GRCh38)
Location 6:159900357-159900379
Sequence AAGAATCCACAAAATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018038329_1018038331 -8 Left 1018038329 6:159900342-159900364 CCACCGACAGAGTTGAAGAATCC No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038324_1018038331 19 Left 1018038324 6:159900315-159900337 CCAACCTCAAATATCCCCGTCAG No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038327_1018038331 4 Left 1018038327 6:159900330-159900352 CCCGTCAGTCATCCACCGACAGA No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038322_1018038331 30 Left 1018038322 6:159900304-159900326 CCTCACACTTCCCAACCTCAAAT No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038325_1018038331 15 Left 1018038325 6:159900319-159900341 CCTCAAATATCCCCGTCAGTCAT No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038328_1018038331 3 Left 1018038328 6:159900331-159900353 CCGTCAGTCATCCACCGACAGAG No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038326_1018038331 5 Left 1018038326 6:159900329-159900351 CCCCGTCAGTCATCCACCGACAG No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data
1018038323_1018038331 20 Left 1018038323 6:159900314-159900336 CCCAACCTCAAATATCCCCGTCA No data
Right 1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018038331 Original CRISPR AAGAATCCACAAAATGACCA AGG Intergenic
No off target data available for this crispr