ID: 1018040295

View in Genome Browser
Species Human (GRCh38)
Location 6:159915862-159915884
Sequence CTGGAAGGGCGAAGGAGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018040288_1018040295 -7 Left 1018040288 6:159915846-159915868 CCTCAGAACTGCCCTCCTGGAAG 0: 1
1: 0
2: 2
3: 27
4: 281
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213
1018040285_1018040295 -3 Left 1018040285 6:159915842-159915864 CCCACCTCAGAACTGCCCTCCTG 0: 1
1: 1
2: 1
3: 36
4: 324
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213
1018040284_1018040295 -2 Left 1018040284 6:159915841-159915863 CCCCACCTCAGAACTGCCCTCCT 0: 1
1: 0
2: 3
3: 62
4: 423
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213
1018040286_1018040295 -4 Left 1018040286 6:159915843-159915865 CCACCTCAGAACTGCCCTCCTGG 0: 1
1: 0
2: 2
3: 34
4: 361
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213
1018040282_1018040295 13 Left 1018040282 6:159915826-159915848 CCCAGGACAGTGAGGCCCCACCT 0: 1
1: 0
2: 2
3: 20
4: 240
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213
1018040283_1018040295 12 Left 1018040283 6:159915827-159915849 CCAGGACAGTGAGGCCCCACCTC 0: 1
1: 0
2: 1
3: 31
4: 429
Right 1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG 0: 1
1: 0
2: 1
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018040295 Original CRISPR CTGGAAGGGCGAAGGAGCCG TGG Exonic
900145594 1:1157569-1157591 CAGGAAGGGGGAAGGCGACGAGG + Intergenic
900332681 1:2144068-2144090 CCGGAAGGGACAAGGTGCCGGGG + Intronic
900565777 1:3331233-3331255 CTGGCAGGGGGAAGGGGCAGTGG - Intronic
900957824 1:5898427-5898449 CTGGAGGAGCCAAGGAGCCCAGG - Intronic
901620316 1:10580016-10580038 CAGGAAGGGATAAAGAGCCGTGG + Intronic
901628388 1:10636200-10636222 CAGGAAGGAGGAAGGAGCCGAGG + Intergenic
902201688 1:14838175-14838197 ATGGAAGGGCAAAAGAGCTGTGG + Intronic
902277532 1:15350378-15350400 CTGGAAGGGAAAAGGAGCCTGGG + Intronic
902876044 1:19341496-19341518 GTGGAAGGCGGAAGGAGCAGGGG + Intronic
903662061 1:24984346-24984368 CTGGAAGGGCTAAGGGGGTGTGG + Intergenic
903911675 1:26731390-26731412 CTGGGAGGGGTATGGAGCCGGGG - Exonic
906145741 1:43558963-43558985 CTGGGAGGGACAAGGAGGCGGGG + Intronic
906675275 1:47688752-47688774 CTGGAAAGGAGCTGGAGCCGTGG - Intergenic
907433647 1:54430106-54430128 CTGGAAGGAGGAAGGAGGTGGGG + Intergenic
912100861 1:106202389-106202411 CTGAAAGGGCAAGGGAGCTGGGG + Intergenic
912430599 1:109626539-109626561 CTGGAGGGGCGGAGGGGCAGAGG + Intronic
915163185 1:153933694-153933716 CTGGAAGGGCTAAGTGGGCGGGG - Exonic
915312175 1:155010336-155010358 CACGAAGGGGGAAGGAGGCGAGG - Exonic
915344362 1:155190865-155190887 CTGGGGGGGCGGTGGAGCCGGGG + Intronic
915457947 1:156053308-156053330 CGGGAAGGGGGAAGGACCCTGGG - Intronic
916029235 1:160862104-160862126 CTGGATGGCTGAAGAAGCCGGGG + Intronic
917120869 1:171643469-171643491 CTGGCAGGGCCAGGGAGCGGTGG - Intronic
920086954 1:203424408-203424430 CTGGAAGACAGAAGGAGCCTAGG - Intergenic
920203883 1:204277456-204277478 CTGGACGGGTGAAGGAGTCTGGG + Intronic
920274683 1:204795366-204795388 CTAGAAGGAAGAAGGAGCAGAGG + Intergenic
1063095235 10:2903222-2903244 CAGGAATGGTGAAGAAGCCGAGG + Intergenic
1063422049 10:5920755-5920777 CTGGAGGGGCGAAGGAAGCAGGG + Intronic
1063878932 10:10510894-10510916 CTTGAAGGGAGAAGGAGCAAGGG + Intergenic
1067704428 10:48596444-48596466 CTGGAGGGGGCAGGGAGCCGGGG + Intronic
1070191937 10:74118976-74118998 CTGGAAGGGCAGAGTAGCCAGGG + Exonic
1074715617 10:116215873-116215895 CTGGTGGGGAGAGGGAGCCGGGG - Intronic
1076701045 10:132272870-132272892 CAGGGAGGGTGGAGGAGCCGAGG - Intronic
1079737343 11:24013243-24013265 GTGGAAGAGCGAAGGAGGCTTGG + Intergenic
1080687090 11:34524776-34524798 CTGGTGGGACGAAGGAGCTGAGG - Intergenic
1080732037 11:34966720-34966742 CTGTAGGGGCGAAGGTGCTGTGG - Exonic
1081860986 11:46333235-46333257 CCGAAAGGCCGCAGGAGCCGCGG + Intronic
1083711238 11:64550202-64550224 CTTGAAGGGTGAGTGAGCCGTGG - Intergenic
1084698489 11:70770501-70770523 CTGGAGCGGCCAATGAGCCGGGG + Intronic
1085101280 11:73802469-73802491 CTGGAAGGGCTGGGGAGCTGTGG - Intronic
1085266579 11:75241117-75241139 CTGGAAGGGGCAGGGTGCCGCGG - Exonic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1086464459 11:87038372-87038394 CTGCAAGGGAGAAGGAGGAGGGG + Intronic
1092090054 12:5797067-5797089 CTGGAAGAGTGACGGAGCAGGGG - Intronic
1092487447 12:8914675-8914697 CTGGAGGGGCGGGGGCGCCGAGG - Exonic
1094530974 12:31274483-31274505 CTGGAAGGGGGAAGGTGACAAGG + Intergenic
1096233849 12:49912674-49912696 CAGGAAGGGCTGAGGAGCCCTGG - Intergenic
1096709211 12:53443195-53443217 CTGGAAGGGCTAGGGAGAGGAGG - Intronic
1096792428 12:54053481-54053503 CTGGAAAAGCTCAGGAGCCGAGG + Intronic
1096946725 12:55414966-55414988 CTGGAGGGGCGGGGGCGCCGAGG + Intergenic
1098991131 12:77065745-77065767 CCGGAAGGGGGAGGGGGCCGAGG - Intergenic
1100987182 12:100213376-100213398 CTCGAAGGCCCAAGGAGCTGTGG - Intronic
1104939830 12:132389931-132389953 CTGGAAGGGCGGAGGAGCCTGGG - Intergenic
1106694895 13:32162777-32162799 CTGGAAGGAAGAAGGATCCACGG - Intronic
1107267839 13:38578857-38578879 CTAGAGGAGAGAAGGAGCCGAGG - Intergenic
1108240479 13:48458118-48458140 CAGGAAGCCCGGAGGAGCCGGGG - Intronic
1108577717 13:51803947-51803969 GCGAGAGGGCGAAGGAGCCGCGG + Intronic
1111354520 13:87080508-87080530 CTGGAAGGGGGAAGATGCCAGGG + Intergenic
1113910403 13:113838722-113838744 CTGGAGCAGGGAAGGAGCCGGGG + Intronic
1118171778 14:63395719-63395741 GTGGAAGGGAGGAGGAGCAGAGG + Intronic
1120749022 14:88180450-88180472 CTTGAAGGGAGAAGGTGCAGTGG - Intronic
1122324046 14:100872086-100872108 CTGGGAGGGAGGAGGAGCTGAGG - Intergenic
1122620935 14:103057403-103057425 CTGGGAGGGCGGCGGCGCCGAGG - Exonic
1124748386 15:32356636-32356658 CTGGAAGAGCGAAGGGCCAGAGG - Intergenic
1125462528 15:39920415-39920437 CTCGAGGGGCGGAGGACCCGCGG - Exonic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1128052475 15:64676045-64676067 CTGGCAAGGCCAAGGAGCCAGGG + Exonic
1129488896 15:75904209-75904231 CAGGTAGGGCGAGCGAGCCGGGG - Intronic
1130978113 15:88792737-88792759 ATGGAAGGGCCAAGGTGCCAGGG + Intergenic
1132058894 15:98674406-98674428 CTGGAAGGACGAGGAAGCCTAGG - Intronic
1134038682 16:11051448-11051470 TTGGAAGGAGGAAGGGGCCGGGG - Intronic
1134303213 16:13009725-13009747 CTGCAAGGGCCAAGCAGCCAAGG + Intronic
1134844907 16:17431867-17431889 GTGGAAGGGAGAAGCAGCCATGG + Intronic
1136551273 16:30983821-30983843 ATGGAAGGGCGTGTGAGCCGTGG - Intronic
1137542507 16:49374583-49374605 CTAGAAGGGCCAAGGGGCAGTGG + Intronic
1138279247 16:55760618-55760640 CTGGAAGGGCGACAGTTCCGGGG - Intergenic
1138286251 16:55812577-55812599 CTAGAAGGGGGAAGGAGTGGAGG - Intronic
1138894764 16:61189983-61190005 CTGGAAGGACTGAGGAGCTGAGG + Intergenic
1139662875 16:68433707-68433729 CTGGACGAGCGAAGAAGCCCAGG + Intronic
1142127328 16:88416761-88416783 CTGGAAGGGCGAAGGGTGCGTGG - Intergenic
1142253303 16:89002504-89002526 CTGGGGGGACGGAGGAGCCGGGG + Intergenic
1142253488 16:89003021-89003043 CCGGAGGGACGCAGGAGCCGGGG + Intergenic
1143140240 17:4738536-4738558 CTGGAATGAGGAAGGAGCCGGGG - Intronic
1144025410 17:11272408-11272430 CTGCAAGGACGGAGGAGCCCAGG - Intronic
1144219380 17:13086215-13086237 TTGGAAGGGTGAAGGAGGCTGGG - Intergenic
1145908405 17:28528774-28528796 CTGGAAGGGTGCAGGGGCCGAGG + Intronic
1148432038 17:47650282-47650304 CCGGTAGGACGCAGGAGCCGGGG + Exonic
1148674689 17:49438566-49438588 CTGGATGGGGGAGGGGGCCGGGG + Intronic
1150692259 17:67377072-67377094 TTCAAAGGGCAAAGGAGCCGAGG + Intergenic
1151091096 17:71440872-71440894 CTGGAAGGAAGTAGGAGTCGGGG + Intergenic
1151268858 17:72977873-72977895 CTGGGAGAGCGAAGGTGCCCAGG + Intronic
1151538132 17:74749919-74749941 CTGGCAGGGAGGAGGAGCCAAGG + Intronic
1152143495 17:78552688-78552710 CTGGAATGGCGAAGGTACGGAGG - Exonic
1159688222 18:71450397-71450419 CTGGAATGGCAAAGGAGCATTGG - Intergenic
1160733495 19:651596-651618 CTGGAAGGGTGAGGGGGCCCCGG - Exonic
1160971169 19:1768412-1768434 CTGGAAGAGCTCAGGAGCCCAGG + Intronic
1161227133 19:3151884-3151906 TAGGAAGGGCAAAGGAGCTGGGG + Intronic
1162720116 19:12657243-12657265 TTGGAGGGGGGAAGGAGGCGGGG - Intronic
1163039084 19:14589121-14589143 TGGGAAGGGGGAAGGAGTCGAGG - Intronic
1164382988 19:27751298-27751320 CTGGGAGGGCCAATGAGTCGGGG + Intergenic
1164533162 19:29063335-29063357 CTGAAAGGGCTAAGGTCCCGTGG - Intergenic
1165096545 19:33412837-33412859 CTGGGAGAGCGCAGGAGACGAGG + Intronic
1166317803 19:41998634-41998656 CGAGAAGGGCGCAGGAACCGAGG - Exonic
1166347638 19:42176495-42176517 CTGAAAGGACGGAGGAGCGGAGG - Intronic
1166910834 19:46155174-46155196 CTGGATGGGAGAAGGAGCCCCGG + Intronic
1166923137 19:46245598-46245620 CTGGATGGGAGAAGGAGCCCCGG - Intergenic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
1168295701 19:55376562-55376584 CTGGAAGGGCGTGGGAGTCTGGG - Intergenic
1168471227 19:56642810-56642832 GCGGAAGGGAGAAGGAGCTGGGG - Intergenic
927813209 2:26191925-26191947 CTGGGAGGGTGAAGGGGCCAAGG + Intronic
927843032 2:26457328-26457350 CTGGAAGGGCAAGGGGGCAGGGG + Exonic
931102567 2:59018912-59018934 ATGGCAGGGCGGGGGAGCCGGGG - Intergenic
934852888 2:97712678-97712700 CTAGAGGGGAGATGGAGCCGAGG + Intergenic
935259735 2:101344041-101344063 CTGGATGTGGGCAGGAGCCGGGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
940562848 2:155323506-155323528 CAGGAAGGGAGAAGGACCAGAGG - Intergenic
942748778 2:179264819-179264841 CGGGAAGGAGGAAGGAGGCGGGG + Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
947722627 2:232378993-232379015 CTGGAACCGCGAGGCAGCCGAGG + Exonic
948560250 2:238847371-238847393 CGGGAAGGGCGTCGGGGCCGGGG + Intergenic
1168760469 20:346992-347014 CTGGAAGGGGACAGGAGCCGGGG + Intronic
1168854939 20:1001957-1001979 CTGGAGGAGCGAAGGACCCAGGG + Intronic
1169276531 20:4236853-4236875 CTAGAAGGTGGAAGGGGCCGGGG + Intronic
1170443094 20:16398415-16398437 CAGGAAGGGCTAAGGAGGTGTGG + Intronic
1170955432 20:20975054-20975076 TTGAAAGGGCGAAGGATCCCAGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172407099 20:34698048-34698070 CTGGAAGTGGGAGGGAGCCAAGG + Intronic
1172519301 20:35556883-35556905 CAGGAAAGGGGAAGGAGCAGGGG + Intronic
1172636005 20:36410378-36410400 ATGGAAGGGCGAGGGAGTTGGGG - Intronic
1173241668 20:41302447-41302469 CGGGAAGGGCCAAGGGGCCTAGG - Intronic
1175563647 20:59954828-59954850 CTGGAAGAGGGAGGGAGCAGAGG - Intergenic
1175898359 20:62350169-62350191 GAGGAAGGGCGCGGGAGCCGGGG - Intronic
1178439920 21:32590461-32590483 CAGGAAGGGACCAGGAGCCGAGG + Intronic
1178953898 21:37006621-37006643 CTGGGAGGGGGCAGGACCCGAGG - Exonic
1179406101 21:41127201-41127223 CAGGAAGGGAGCAGGAGCCAAGG - Intergenic
1179954882 21:44733074-44733096 CTGGGAGGGCGGGGCAGCCGGGG - Intergenic
1180064112 21:45404524-45404546 CTGGGAGGGAGGAGGAGCCTGGG + Intergenic
1180686401 22:17670604-17670626 TTGGGAGGCCGAAGCAGCCGAGG - Intronic
1180758174 22:18177724-18177746 CTTGAAGGGGCAAGGAGGCGAGG + Intergenic
1180768461 22:18361516-18361538 CTTGAAGGGGCAAGGAGGCGAGG + Intergenic
1180777849 22:18500875-18500897 CTTGAAGGGGCAAGGAGGCGAGG - Intergenic
1180810575 22:18758186-18758208 CTTGAAGGGGCAAGGAGGCGAGG - Intergenic
1181196718 22:21192441-21192463 CTTGAAGGGGCAAGGAGGCGAGG - Intergenic
1181212807 22:21300683-21300705 CTTGAAGGGGCAAGGAGGCGAGG + Intergenic
1181513732 22:23400218-23400240 CTGGATGGGCGAGGCAGGCGTGG + Intergenic
1181765025 22:25085273-25085295 CTGGGAGGGCAGAGGAGCCAAGG + Intronic
1182394935 22:30028413-30028435 CTGTAAGAGCTAAGGAGCAGAGG - Intronic
1184146483 22:42614571-42614593 CTGGGAGGCCGACGGGGCCGCGG - Intronic
1184238347 22:43198475-43198497 CTGGAAGGGCCAGGGATCTGTGG + Exonic
1185014106 22:48333494-48333516 CTGCAAGGGCGCAGGAGCTCGGG + Intergenic
1203230079 22_KI270731v1_random:102404-102426 CTTGAAGGGGCAAGGAGGCGAGG + Intergenic
951962883 3:28348815-28348837 CTGGAAGGAGGGACGAGCCGAGG + Exonic
952255088 3:31688085-31688107 AAGGAAGGGCGTAGGAGGCGTGG + Intronic
953055103 3:39381678-39381700 CTGGAAGGGTGAGGGAGTGGAGG + Intergenic
953534836 3:43769733-43769755 AAGGAAGGCGGAAGGAGCCGGGG - Intergenic
954335308 3:49912935-49912957 GAGGAGGGGAGAAGGAGCCGGGG + Intronic
956918437 3:73899768-73899790 CTGGAAGGGCCAGGGAGCATAGG - Intergenic
962849291 3:139295845-139295867 GTGGAAGGGAGAAGGAGACCAGG - Intronic
967982311 3:195073030-195073052 CTGCCAGGGAGAGGGAGCCGAGG - Intronic
969417789 4:7072360-7072382 ATGCAAGGGGGAAGGAGCGGTGG - Intergenic
978270072 4:106878370-106878392 CTGCAAAGGGGAAGGAGCAGTGG - Intergenic
983517362 4:168672398-168672420 CTGGAAAGGGGAAGGAGAAGGGG - Intronic
984744582 4:183202013-183202035 TTGGAAGGCAGAAGGAGCAGAGG + Intronic
986707561 5:10464096-10464118 GTGGAAGGGACAAGGAGACGAGG - Intronic
988482095 5:31639391-31639413 CTGGACGCGCGAGGAAGCCGCGG + Exonic
997526448 5:134556010-134556032 CAGGAAGGATGAAGGAGACGGGG - Intronic
1000737331 5:164921126-164921148 CTGGCAGGGAAAAGGAGCCCTGG - Intergenic
1001316054 5:170641961-170641983 TGGGAAGGGCGACAGAGCCGGGG - Intronic
1004319372 6:14620816-14620838 CTGGGAGGCTGGAGGAGCCGTGG - Intergenic
1004972584 6:20928203-20928225 ATGGAAGGGGGAAGGTGCCACGG + Intronic
1007801905 6:44401520-44401542 CTGGAGGGGAGAAGGAGTCCTGG + Intronic
1010154019 6:72770993-72771015 CTAGAAGGGGGAAGGGGGCGGGG + Intronic
1011734581 6:90297597-90297619 CTGGAAGGCAGTAGGAGCTGGGG - Intergenic
1012619141 6:101317682-101317704 ATGGAAGGGCCAAGGTGCCAAGG - Intergenic
1013773325 6:113651221-113651243 GTGGAGGGGCAAAGGAGCCCAGG + Intergenic
1014017259 6:116547437-116547459 CTGGAAGGTCAATGGAGCAGAGG - Intronic
1016754779 6:147673107-147673129 CTGTAAGAGCCAAGGAGCCAAGG - Intronic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1018050682 6:160005773-160005795 CTCGAGGGGCCAAGGAGGCGCGG - Intronic
1019179196 6:170176397-170176419 CTGGAAGGGCGGGGGCGCCTGGG + Intergenic
1019576244 7:1739054-1739076 CTGGGAGTGAGAAGGAGCGGAGG + Intronic
1019979896 7:4613782-4613804 CTGGAAGGGAGTAGGAGGAGGGG - Intergenic
1020125442 7:5530448-5530470 CTGCACGGGCGAAGGGGCCGCGG + Intronic
1020133073 7:5570342-5570364 CTGGAGGCGCGGATGAGCCGCGG + Intergenic
1020261238 7:6531738-6531760 CTGGGAAGAGGAAGGAGCCGTGG + Intronic
1020931754 7:14405848-14405870 CAGGAAGGACAAAGGAACCGAGG + Intronic
1022832161 7:34078962-34078984 CTGGAAGGGCGAGGCAGGGGAGG - Exonic
1024243477 7:47452961-47452983 CTGGAAGGGAAAAGCAGCCCTGG - Intronic
1025069666 7:55887571-55887593 CCGGGAGGGAGAAGGTGCCGAGG - Intronic
1027821364 7:83049514-83049536 ATGGAAGAGTGAAGGAGCTGAGG + Intronic
1030041346 7:105453121-105453143 CTTGCAGGGGGAAGGAGCCTGGG + Intronic
1030067842 7:105674077-105674099 ATGGCAGGGCTGAGGAGCCGAGG + Intronic
1030678275 7:112407601-112407623 CTGCAAAGGCGAAGAAGCCCTGG + Intergenic
1031406784 7:121396130-121396152 CTGGGAGGCGGACGGAGCCGGGG - Intronic
1035169307 7:157009091-157009113 CTGGAAGGGCGTTGGATCCGGGG - Intronic
1037487223 8:19358936-19358958 GTGGAGGGGCGGAGGGGCCGAGG - Intronic
1037632044 8:20667025-20667047 CTGAAAGAGGGAAGGAGCAGAGG + Intergenic
1040387131 8:46921237-46921259 CTGGAAAGGAGAATGAGCTGCGG + Intergenic
1040493878 8:47949107-47949129 CTGGAAGGCGGCAGGAGCCAAGG - Intronic
1040604870 8:48921690-48921712 TAGGAGGGGCGCAGGAGCCGGGG + Exonic
1041278262 8:56186124-56186146 CAAGAAGGGTGAAGGAGCCATGG + Intronic
1047372168 8:124265171-124265193 CTGGAAGGTGGAAGGAGATGAGG - Intergenic
1047454611 8:124998117-124998139 CAGGGAGGGCGCAGGAGCTGGGG + Intergenic
1049148456 8:141019275-141019297 CTGGAAGAGCAAAGAAGCAGAGG + Intergenic
1050343341 9:4662576-4662598 CGGCCAGGGGGAAGGAGCCGCGG - Exonic
1053297940 9:36928249-36928271 CTGGAATGGCTGAGGAGCTGTGG - Intronic
1054755363 9:68952025-68952047 CTGGAAGGGTGTAGGAGGAGGGG - Intronic
1055331395 9:75187671-75187693 CTGGAAGAGGCAAGGAACCGGGG + Intergenic
1055512830 9:77012240-77012262 CAGGAAGAGTCAAGGAGCCGGGG + Intergenic
1057044917 9:91878293-91878315 ATGGAGGTGCGAAGGAGCCCAGG - Intronic
1059355712 9:113697911-113697933 ATGAAAGGGCGAAGGAACTGCGG - Intergenic
1060228060 9:121808246-121808268 GAGCAAGGGCGGAGGAGCCGGGG + Intergenic
1061205769 9:129162382-129162404 CAGGAAGGGAGAAGGGGCCAAGG + Intergenic
1061240093 9:129365053-129365075 TTGGAAGGACGAAGGAGTGGGGG - Intergenic
1061590056 9:131592298-131592320 TGGGATGGGCGAGGGAGCCGAGG + Intronic
1061721875 9:132556921-132556943 CTGGCGTGGCGAAGGAGACGCGG - Intronic
1061820793 9:133226300-133226322 CTGGAAGGGTGCAGGAGCTGCGG - Intergenic
1061822141 9:133234773-133234795 CCGGAAGGGCGAGGGAGCCTCGG - Intergenic
1061832511 9:133304672-133304694 CCGGAAGGGCGAGGGAGCCTCGG + Intergenic
1061868080 9:133505716-133505738 CTGGTAGGGCGAAGGCACCATGG + Intergenic
1062237152 9:135515743-135515765 CCGGAAGGGCGAGGGACCCTGGG + Intergenic
1062238484 9:135523766-135523788 CTGGGAGGGTGCAGGAGCTGCGG + Intronic
1062324315 9:136004995-136005017 CTGCAAGGGCGAGGCGGCCGTGG + Intergenic
1062432632 9:136532839-136532861 CTGGAAGGGGGAAGGTCTCGTGG + Intronic
1203781234 EBV:101954-101976 CAGGAATGGCCGAGGAGCCGAGG - Intergenic
1186333840 X:8565002-8565024 CAGGAAGGGTGAAGAAGCTGTGG + Intronic
1189323702 X:40100771-40100793 CTGTAAATGCGAAGGGGCCGAGG + Intronic
1189761506 X:44326230-44326252 CTGGAAAGGGGAAGGAGAGGAGG + Intronic
1191937090 X:66437756-66437778 GGGGAAGGGCGAAGGAGGAGTGG - Intergenic
1198230236 X:134682374-134682396 CTGGATGGGGCAAGGAGCCCTGG + Intronic