ID: 1018043270

View in Genome Browser
Species Human (GRCh38)
Location 6:159943761-159943783
Sequence GTACAGTCCTCAGCTGAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018043270_1018043272 24 Left 1018043270 6:159943761-159943783 CCGCTTTCAGCTGAGGACTGTAC No data
Right 1018043272 6:159943808-159943830 CATAAAACATTTCCTAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018043270 Original CRISPR GTACAGTCCTCAGCTGAAAG CGG (reversed) Intergenic
No off target data available for this crispr