ID: 1018047658

View in Genome Browser
Species Human (GRCh38)
Location 6:159979493-159979515
Sequence ACGCTGCCTGTCACTCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018047658_1018047667 27 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047667 6:159979543-159979565 ATGCGGAGGGAGAGGAGAGCTGG 0: 1
1: 0
2: 7
3: 73
4: 690
1018047658_1018047664 13 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047664 6:159979529-159979551 TGACTTTGCTGGACATGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1018047658_1018047668 30 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047668 6:159979546-159979568 CGGAGGGAGAGGAGAGCTGGTGG 0: 1
1: 1
2: 14
3: 117
4: 904
1018047658_1018047663 10 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047663 6:159979526-159979548 CCTTGACTTTGCTGGACATGCGG 0: 1
1: 0
2: 2
3: 19
4: 170
1018047658_1018047666 19 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047666 6:159979535-159979557 TGCTGGACATGCGGAGGGAGAGG No data
1018047658_1018047665 14 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047665 6:159979530-159979552 GACTTTGCTGGACATGCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1018047658_1018047661 2 Left 1018047658 6:159979493-159979515 CCCTTTAGAGTGACAGGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1018047661 6:159979518-159979540 GCTCATGGCCTTGACTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018047658 Original CRISPR ACGCTGCCTGTCACTCTAAA GGG (reversed) Intronic
905720279 1:40194277-40194299 AGGCTGCCTGTTCCTCTAACAGG - Intronic
911041789 1:93597073-93597095 ACTCTCCCTGTGCCTCTAAAAGG - Intronic
912970348 1:114275535-114275557 AATCTTCCTGTCACACTAAAGGG + Intergenic
923311158 1:232736926-232736948 GCAATGCCTGTCACTCTAAGGGG - Intergenic
1074999064 10:118782071-118782093 AGACTGCCTGTCCCTCTATATGG - Intergenic
1075535508 10:123268900-123268922 AGGCTGCCTGTCCATCAAAATGG - Intergenic
1076054830 10:127364009-127364031 ACGGTGCCTGGCACTATAAAAGG + Intronic
1078084147 11:8223873-8223895 GTGCTGTCTGTCACCCTAAAAGG + Intergenic
1081840681 11:46199278-46199300 ACGCTGCCTGGCAGTGTACAAGG - Intergenic
1082098118 11:48147800-48147822 GCTCTGCCTGTCACTCCAACAGG - Intronic
1092530955 12:9344457-9344479 GTGCTGCCTTTCATTCTAAATGG + Intergenic
1092995744 12:13948839-13948861 ACAATGCCAGTGACTCTAAATGG - Intronic
1094172474 12:27508222-27508244 AGGCTGCATGTCACTTGAAAAGG - Intergenic
1103590527 12:121989269-121989291 AGGGTGACAGTCACTCTAAAGGG + Intronic
1107162136 13:37242351-37242373 ATGCTGCCTGTTCCACTAAAAGG + Intergenic
1108903681 13:55444676-55444698 ATGCAGCCTATCACTCAAAAGGG + Intergenic
1108924438 13:55722714-55722736 ACCCTGCTTTTTACTCTAAAGGG - Intergenic
1112251354 13:97783618-97783640 ACAGTGGCTGTCCCTCTAAAGGG + Intergenic
1114223683 14:20719363-20719385 ACTTTGCCTGTCTCTATAAATGG - Intergenic
1116261432 14:42633206-42633228 ATGTTGCATGTAACTCTAAAAGG + Intergenic
1116321990 14:43479604-43479626 ACTTTGCCTTTCACTTTAAAGGG + Intergenic
1122004559 14:98691329-98691351 ATGCTGCCTGTCTCTCTATGAGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1136118836 16:28115554-28115576 ACTTTGCCTGTCTCTATAAATGG - Intronic
1137386304 16:48045658-48045680 AGGCTTGCTGTCACTCTAACAGG + Intergenic
1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG + Intronic
1149532980 17:57410227-57410249 ACTTGGCCTGACACTCTAAAAGG + Intronic
1149535895 17:57433062-57433084 ATGGTGCCTGTCACTCTGGAAGG - Intronic
1150601068 17:66651518-66651540 AGCCTGCCTGTCACTGCAAAAGG - Intronic
1159006850 18:63020864-63020886 TCTCTTCCTGTCACTCTCAAAGG - Intergenic
1167414547 19:49363180-49363202 ACGCAGCCTTTCACCCTTAAGGG - Intronic
931216261 2:60247730-60247752 CGGCTGCCTGTCACTCAAATGGG - Intergenic
931653933 2:64492793-64492815 AAACTGCTTGCCACTCTAAATGG + Intergenic
932218099 2:69979629-69979651 AAGGGGCCTGTCACTCTCAAGGG - Intergenic
942481248 2:176390841-176390863 ACTCTGCCTGTCATTCTCACTGG + Intergenic
943589116 2:189776461-189776483 ACACTGCCTATGAGTCTAAATGG - Intronic
1178342793 21:31800472-31800494 CCTCTGCCTCTCACTCTAACTGG - Intergenic
1181876906 22:25946684-25946706 ACCCTGCTTGCCACTCTAAGTGG + Intronic
953891400 3:46754205-46754227 ACACTGCCTGTCACACAGAAGGG + Intronic
953896882 3:46809873-46809895 ACACTGCCTGTCACACAGAAGGG + Intronic
956957221 3:74355166-74355188 AGGTTCCCTGTCACTCTGAATGG + Intronic
965486297 3:169282623-169282645 ACGCTGCCATTCACAGTAAAAGG + Intronic
970587299 4:17526801-17526823 ACGCCGCCTGAAACTCAAAAAGG - Exonic
979659008 4:123230994-123231016 ACTCTTCCTGTCTCTATAAATGG - Intronic
985946950 5:3193167-3193189 ATGCTGCCTGTCTCTGGAAATGG - Intergenic
988339303 5:29949440-29949462 AGGCTGCCTTTCACTCAAAGGGG - Intergenic
992433276 5:76730724-76730746 ACGCTGCCTTCCACTTCAAATGG + Intronic
994541157 5:101099381-101099403 AGTGTACCTGTCACTCTAAAAGG - Intergenic
995648133 5:114336759-114336781 GCGCTTTCTGTCACTCTGAATGG - Intergenic
995886962 5:116905985-116906007 ACTCTTCCTTTCACTCTAAGTGG - Intergenic
1004321792 6:14637454-14637476 ACGATGCCTGTCACTCCACTCGG + Intergenic
1004528684 6:16433675-16433697 ATGCTGCCTGTCACAGTTAAAGG - Intronic
1007286745 6:40753332-40753354 ACACTGCCTGTCAGTCTCAAGGG - Intergenic
1008331528 6:50250940-50250962 ACACTGCCTGGCACTCACAAAGG + Intergenic
1018047658 6:159979493-159979515 ACGCTGCCTGTCACTCTAAAGGG - Intronic
1018914961 6:168127517-168127539 CAGCTGCCCGTCACTCTAGACGG + Intergenic
1021473225 7:21030268-21030290 AAGCCGCCTTTCACTCAAAAAGG - Intergenic
1021546524 7:21819375-21819397 AAGTTGTCAGTCACTCTAAATGG - Intronic
1023488041 7:40708126-40708148 CTGCTTCCTGTCACTTTAAATGG - Intronic
1025611338 7:63077798-63077820 ACTCTGCCTGTCACAGAAAATGG + Intergenic
1025994914 7:66522124-66522146 ACGCTGCCTCTCACTCCTGACGG + Intergenic
1026462894 7:70630456-70630478 ACGGGGCCTGTCACTTTAACTGG + Intronic
1026986546 7:74558813-74558835 ACGCTGCCTCTCACTCCTGACGG + Intronic
1027501402 7:78956350-78956372 ATGCTGCCTGATTCTCTAAAGGG + Intronic
1036208037 8:6819525-6819547 AGGCTGCCTCACACTCTGAATGG + Intronic
1057858872 9:98624223-98624245 ACGCTGCCTGTGAGTCCAAGGGG - Intronic
1058933523 9:109746160-109746182 CTGCTGGCTGTCACTCTAAGTGG - Intronic
1191232260 X:58105328-58105350 ATGGTGCCAGTCACTCTAATGGG + Intergenic
1192608462 X:72544137-72544159 AAGCTGCCTGTCTCTCTGAAAGG + Intronic
1197811113 X:130443913-130443935 ACTATCCCTGCCACTCTAAATGG - Intergenic