ID: 1018054459

View in Genome Browser
Species Human (GRCh38)
Location 6:160040022-160040044
Sequence GCTCCCAGTGAAGCACGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018054459_1018054462 18 Left 1018054459 6:160040022-160040044 CCTTGGCGTGCTTCACTGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1018054462 6:160040063-160040085 TCCACTCTTGTTTTACTTTAGGG 0: 1
1: 0
2: 2
3: 20
4: 300
1018054459_1018054460 -7 Left 1018054459 6:160040022-160040044 CCTTGGCGTGCTTCACTGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1018054460 6:160040038-160040060 TGGGAGCGACTGACTATAGATGG 0: 1
1: 0
2: 0
3: 8
4: 55
1018054459_1018054461 17 Left 1018054459 6:160040022-160040044 CCTTGGCGTGCTTCACTGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1018054461 6:160040062-160040084 TTCCACTCTTGTTTTACTTTAGG 0: 1
1: 0
2: 2
3: 39
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018054459 Original CRISPR GCTCCCAGTGAAGCACGCCA AGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900372841 1:2339899-2339921 GCTCCCCGTGGAGCACGGCTTGG + Intronic
900537948 1:3188019-3188041 GGCCCCAGTGAAGCAGGACAGGG + Intronic
902887188 1:19414065-19414087 GCTCTCCGTGAAGCAGCCCATGG - Intronic
907341120 1:53737174-53737196 TCCCCCAGTGAAGCTGGCCACGG - Intergenic
915326456 1:155083424-155083446 GCTCCCAGTGCCGCAGGCCGAGG + Intronic
918216009 1:182392147-182392169 GCTCCCAGCAAAGCCCGCCCTGG + Exonic
922469773 1:225868872-225868894 CCTCCAAGTGTAGCACTCCAAGG - Intronic
1068698488 10:59995018-59995040 GCACCCACTGAAGCAGGCAAAGG + Intergenic
1069679654 10:70274868-70274890 GTTCCCAGGGAAGCAAGCCTTGG + Intronic
1070921094 10:80186833-80186855 GCTTCCAGGGAAGCCTGCCATGG - Intronic
1072682691 10:97518041-97518063 TCTCCCTGGGAAGCAGGCCAAGG - Intronic
1078171022 11:8929331-8929353 CCACCCAGAGGAGCACGCCAGGG + Intronic
1078253404 11:9637115-9637137 GCTGCCAGGGATGCACCCCAGGG - Intergenic
1084899646 11:72300046-72300068 CGTCTCAGTGAAGCACGCAAGGG - Intronic
1086559732 11:88154092-88154114 GATCCCAGCAAAGCATGCCAAGG + Intronic
1089219874 11:116861767-116861789 TCTCCCAGTGAGTCAAGCCAAGG + Intronic
1092161404 12:6317338-6317360 CCTCCGAGTGAAGCAGACCATGG + Exonic
1092214182 12:6669069-6669091 GCACACAGTGAAGCATGCCAAGG - Exonic
1092644165 12:10551379-10551401 GCTGCCAGTGAAGCGCGTCCTGG + Intergenic
1101634274 12:106524870-106524892 GCTCCCACTGAAGGATGCTAGGG - Intronic
1102143653 12:110637670-110637692 GGTCCCAGTGAAGAACCCTAGGG + Intronic
1103037384 12:117667443-117667465 GTTCCCAGTGCAGCCCGGCAGGG + Intronic
1106336961 13:28792248-28792270 CCTCCCAGTCCAGCAAGCCAGGG - Intergenic
1108428326 13:50327836-50327858 TCTCTCAGTGAAGCAAGACAAGG - Intronic
1113562067 13:111289371-111289393 GTTGCCAGTGAAGCACAGCAGGG + Intronic
1113851132 13:113418907-113418929 GCTCCCAGAGAAGAACCCCTGGG + Intergenic
1115729614 14:36254479-36254501 TCTCCCAGTGCAGCCCACCATGG - Intergenic
1115957121 14:38793941-38793963 GCTCCCAGCTAAGCACTCCTAGG + Intergenic
1119164071 14:72477852-72477874 GATTCCAGTCAAGCATGCCAAGG + Intronic
1120685832 14:87535876-87535898 GCTCCCTGTAAAGCACTCCATGG + Intergenic
1128337106 15:66793999-66794021 GCTCTCATTCAAGCACACCAAGG + Intergenic
1129266427 15:74395852-74395874 CCTCCCAGTGAAGTAGGCCTGGG - Intergenic
1132341677 15:101082767-101082789 GGTCCTAGTGAAGCAGGCCACGG + Intergenic
1133210943 16:4263199-4263221 GCTCCCTGTGAGGAAAGCCAGGG - Intronic
1136926125 16:34376136-34376158 GCTCCCAGGGAAACAGGCCCAGG + Intergenic
1136978449 16:35035671-35035693 GCTCCCAGGGAAACAGGCCCAGG - Intergenic
1137275462 16:46930285-46930307 GCTCCCAGTGAGGGAGGCGAGGG - Exonic
1142347932 16:89565788-89565810 GCTCCCAGTGACCCACGCCATGG - Exonic
1148359560 17:47000556-47000578 GCTTCCATTGCAGCACCCCATGG + Intronic
1148586294 17:48783297-48783319 CCTCCCACTGAAGCCCACCAAGG - Intronic
1148864649 17:50622254-50622276 GCTCCAAGTGAAGAAGGGCATGG - Intronic
1150470558 17:65433688-65433710 GCTAACAGTGAAGAACTCCAGGG - Intergenic
1152759645 17:82101201-82101223 GATCCCAGTGAACCGGGCCAAGG - Intergenic
1160892681 19:1387556-1387578 GGTGCCAGTGAAGATCGCCAGGG + Intronic
1162384423 19:10352811-10352833 GATCCCAGTGAAGCGCGGCGGGG - Intronic
925347307 2:3179958-3179980 GCTCCCAGAGATGCACCCCGTGG + Intergenic
931516167 2:63051767-63051789 GATCGCTGTGAAGCAAGCCAGGG - Intronic
932334659 2:70923125-70923147 GCTCCTTGTGAAGCACGACGAGG - Intronic
932817713 2:74874959-74874981 GGTCCAAGTGAAGGAGGCCAAGG - Intronic
940032865 2:149283377-149283399 GGTGCCAGTGAATCAGGCCAAGG - Intergenic
943348505 2:186770073-186770095 GCTTCCAGTGAAGCTCCTCAAGG + Intergenic
944618402 2:201485831-201485853 GATCCCAGTGAAGCAGAACAGGG - Intergenic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
1168838210 20:891761-891783 GCTCCCTTTGAAACACTCCAGGG - Intronic
1172357127 20:34288036-34288058 GCTGCCACAGAAGCACGCCCTGG + Intronic
1172609633 20:36240360-36240382 GCTCTCCATGAAGCACACCAAGG + Exonic
1173297476 20:41772362-41772384 GCTCCCAATGGATCAGGCCAAGG + Intergenic
1173684408 20:44912572-44912594 GCTCCCAGTTAAGCACCTCGAGG + Intronic
1177918534 21:27122651-27122673 GCACCCTGTGAATCAGGCCAAGG + Intergenic
1182075526 22:27492950-27492972 GCTGCCAGGGAAGGAAGCCAAGG - Intergenic
1182359062 22:29736013-29736035 GCTCCCAGCGGAGGACACCATGG + Intronic
1182761409 22:32725248-32725270 GATCCCAGTAAAGCATGCCCTGG + Intronic
1183207963 22:36432549-36432571 GCTCCCAGGGAAGGAGGCCTTGG - Intergenic
956779201 3:72591060-72591082 CTTCCCCGTGAAGCACCCCAGGG + Intergenic
966271213 3:178108424-178108446 GCTCAAAGTAAAGCACGTCAAGG + Intergenic
973839362 4:54845165-54845187 GCACCCAGGGAAGCAAGGCATGG - Intergenic
974055281 4:56977509-56977531 GCTCCCACGGCAGCGCGCCATGG - Exonic
981840905 4:149110646-149110668 GCTCCAAGTGCACCACTCCAAGG - Intergenic
991091474 5:62697600-62697622 TATCCCAGTGAAGAACCCCAAGG + Intergenic
998968271 5:147564090-147564112 GAGCCCAGTGAACCATGCCATGG + Intergenic
1005417759 6:25619663-25619685 GCACCCAGAGAAGAACGCCTGGG - Exonic
1006361683 6:33590476-33590498 GCTCCCAGGGAAGCCCTGCAAGG - Intergenic
1007189344 6:40000025-40000047 GCTGCCTGTGAACCCCGCCATGG + Intergenic
1007477525 6:42128856-42128878 GCTCCCAGTGAGGAAAGCCAGGG + Intronic
1008942894 6:57066430-57066452 ACTCCCAGTGAAGCTTCCCAGGG - Intergenic
1018054459 6:160040022-160040044 GCTCCCAGTGAAGCACGCCAAGG - Intronic
1019345169 7:526241-526263 GCTCCCAGGGAAACAGGCCCCGG - Intergenic
1022701245 7:32762214-32762236 ACTCCCAGTGAAGCGCGTGAAGG - Intergenic
1034327290 7:150248143-150248165 TGTCCCAGGGAAGCAGGCCATGG + Intronic
1034765919 7:153721314-153721336 TGTCCCAGGGAAGCAGGCCATGG - Intergenic
1036443834 8:8804752-8804774 TCTCCCAATGAATAACGCCAGGG + Intronic
1037897139 8:22665483-22665505 GCACCCAGTGCAGCATGGCAGGG + Intronic
1048012354 8:130468166-130468188 GTCCCCAGTGAATCAGGCCAAGG - Intergenic
1049275526 8:141718284-141718306 CCTCCCAGAGAAGCCAGCCATGG + Intergenic
1054834248 9:69659592-69659614 GCTCCCTGTGAAACACAACATGG - Intronic
1055912847 9:81371786-81371808 GCACGCTGTGAAGCAGGCCATGG - Intergenic
1061591902 9:131603216-131603238 ACTCCCAGTGATCCACCCCAGGG - Intronic
1192727117 X:73765249-73765271 GCTCTCAGTGAAACACACCAAGG + Intergenic
1199944703 X:152655985-152656007 GCTCTCATTGCAGCACGTCAGGG - Exonic
1200223351 X:154403013-154403035 GCTCCCCGTGCAGCACGACGCGG + Exonic