ID: 1018055653

View in Genome Browser
Species Human (GRCh38)
Location 6:160050049-160050071
Sequence GCATTTGGTTCCCTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018055653 Original CRISPR GCATTTGGTTCCCTGTAGGG AGG Intronic
901672658 1:10865469-10865491 GCATTTATTTCACTCTAGGGAGG + Intergenic
903132953 1:21290973-21290995 GCATTTGGATGGCTGCAGGGTGG + Intronic
903390004 1:22956938-22956960 ACATTAGGTTGCCTCTAGGGAGG - Intronic
906829291 1:49014713-49014735 GAAGGAGGTTCCCTGTAGGGTGG - Intronic
907425331 1:54375842-54375864 GCCTTTGCTTCCCTGCAGGCAGG - Intronic
912418831 1:109530022-109530044 GGGTTTGGTTTCCTGTGGGGTGG - Intergenic
915064377 1:153212485-153212507 GAATTTGGTTTCCTGCAGAGCGG - Intergenic
1070919441 10:80175013-80175035 GGAATTGGCTCCCTGTAGTGTGG + Intronic
1076982649 11:213044-213066 CCATGTGGACCCCTGTAGGGTGG + Intronic
1078973344 11:16441504-16441526 GCATTTGGATTGCTGCAGGGAGG - Intronic
1080645119 11:34182484-34182506 GCATTGGGTTCTCTGGGGGGGGG + Intronic
1084321945 11:68378025-68378047 GCACTTGGTTCGGTGCAGGGAGG + Intronic
1085550903 11:77370425-77370447 GCCTTTTGTTCACTGTAAGGAGG + Intronic
1087148076 11:94831892-94831914 GGGTTTGGTTCTCTCTAGGGAGG + Intronic
1095888719 12:47215684-47215706 GCCTGTGGTTTCCTGTAGTGTGG + Intronic
1096621865 12:52870287-52870309 GCAGTTGGTTACTTGTGGGGAGG + Intergenic
1097960334 12:65526215-65526237 GCCTCTGGTCCCCTCTAGGGAGG - Intergenic
1099345685 12:81497142-81497164 ACATTTGGTTGTCTCTAGGGAGG - Intronic
1100267570 12:92992208-92992230 GTATTTGGTTTCTAGTAGGGTGG - Intergenic
1101704523 12:107209679-107209701 ACAATTGGTTCTCTGAAGGGGGG + Intergenic
1104368458 12:128199586-128199608 GCTTCTGGTGCTCTGTAGGGAGG - Intergenic
1105765559 13:23555165-23555187 GCATTTAGTTCCCTGTGTGCTGG - Intergenic
1105819068 13:24063533-24063555 GAGTTTGGTTTCCTGCAGGGAGG - Intronic
1109060717 13:57615977-57615999 GCATTTTCTGCCCTGTATGGTGG + Intergenic
1109177584 13:59175406-59175428 GCATTGAGTTCCCTGTATGTGGG - Intergenic
1118040498 14:61910891-61910913 TCATTTGATACCCTGCAGGGAGG - Intergenic
1118547398 14:66906633-66906655 GCTTTTGGTTTCCTGTTGAGAGG + Intronic
1119749432 14:77067002-77067024 GCACCTGCTTCCCTGCAGGGTGG + Intergenic
1125934308 15:43621612-43621634 CCATTTGGTCACCTGTAGGTTGG - Intergenic
1126094469 15:45078193-45078215 GCATTTTGCTCTCTGTAGGTGGG - Intergenic
1127790325 15:62392613-62392635 GCAATTGGCTGCCTGTAGGTTGG - Intronic
1128211832 15:65908742-65908764 GTATTTTGTGGCCTGTAGGGAGG + Intronic
1129221866 15:74135875-74135897 GGATTTGGTTCCCTGCCGGCAGG - Exonic
1136479339 16:30532240-30532262 GCTTTTGCTTCCCTGTATGGAGG + Intronic
1141034182 16:80613541-80613563 AAATTGGGTTCCCTGTAGGAAGG + Intronic
1148260532 17:46179191-46179213 GGATATGGTTCTCTGTTGGGAGG - Intronic
1152054640 17:78014651-78014673 GCATTTGGTACCTTTTAGAGAGG + Intronic
1152535646 17:80949097-80949119 GCATCGGGTTCCCTGGAGGGAGG - Intronic
1153691748 18:7601116-7601138 ACATTTGTTCCCCTGTAGGGTGG - Intronic
1154197663 18:12278464-12278486 GGATCTGATTCCCTGCAGGGAGG + Intergenic
1159106211 18:64003797-64003819 GCCTTTGGTTGACTGGAGGGGGG + Intronic
925047915 2:788615-788637 CCATTTGGCTGCCTGTAGGCTGG + Intergenic
925867517 2:8241689-8241711 ACATTTGTTTCCCTGTAGCTGGG - Intergenic
927464593 2:23327697-23327719 GCATTAGGTGCTCTGTAGAGGGG - Intergenic
930716311 2:54596820-54596842 CCATTTGCCTCTCTGTAGGGAGG + Intronic
932325201 2:70854768-70854790 GGTTTTTGTTCCTTGTAGGGAGG - Intergenic
936961424 2:118078959-118078981 ACATTAGCTTCCCTGTAGGAAGG + Intergenic
938999127 2:136713099-136713121 GCATTTGATTCCCTGGAGCCTGG - Intergenic
939615385 2:144356441-144356463 GCGTTTAGTTCCCCTTAGGGAGG - Intergenic
1169680484 20:8207220-8207242 GCACTTTCTTCCCTGTAGGATGG - Intronic
1175144628 20:56886253-56886275 GCAGTTTGTTCCCTGAGGGGTGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1176655259 21:9582758-9582780 GCATTTCTTTACCTTTAGGGTGG + Intergenic
1182517678 22:30868301-30868323 GCATTTTCTTGCCTGCAGGGAGG + Intronic
951475983 3:23106781-23106803 GGAATGGGTTCCCTGCAGGGAGG - Intergenic
951845226 3:27077795-27077817 GGATTTTTTTCCCAGTAGGGAGG + Intergenic
952092449 3:29905448-29905470 GCAATTGGTTCCATGTTTGGGGG - Intronic
952712532 3:36445792-36445814 GCCTTTGGTTCCCAGTAGAAAGG - Intronic
952978830 3:38718959-38718981 GCATTTTGTTTGCTGTGGGGAGG + Intronic
956689614 3:71863829-71863851 CCATGTGGCTCCCTGTGGGGCGG - Intergenic
956784652 3:72632491-72632513 CCATTTGGTTCCCTGGTGAGAGG + Intergenic
958802365 3:98770812-98770834 GCATTTGCTTCCCTTTGGGCAGG + Intronic
960218989 3:115080459-115080481 GCATTTGTTTCTGTGTAGGAAGG - Intronic
961557491 3:127706585-127706607 GCATATGGCTCCATGTGGGGTGG - Intronic
971239361 4:24873715-24873737 GCATTTGTTTCTTTGTAGGATGG - Exonic
972587753 4:40453775-40453797 TCATCTCCTTCCCTGTAGGGAGG - Intronic
972892368 4:43574793-43574815 GTTTTTGGTTTTCTGTAGGGAGG - Intergenic
976032066 4:80768129-80768151 CCATTTGCTTCCCTTCAGGGAGG + Intronic
982531920 4:156556072-156556094 GCTTTTGGTTTCCTGTTGTGTGG + Intergenic
984538143 4:181002766-181002788 GCATTTGCTTCCTTGTAGACTGG - Intergenic
985353042 4:189087127-189087149 GCATTTGTTTGCCTTAAGGGTGG + Intergenic
989258296 5:39390487-39390509 GCATTTGGTTACGTGTGTGGAGG - Exonic
992400910 5:76410504-76410526 GCATTTGGTGCCCTGTCTGCTGG + Intronic
998204747 5:140150386-140150408 GCATTTGGTCCCTGGTAGGCAGG + Intergenic
1006794405 6:36722502-36722524 GCCCTTGGTTCCCTGGAGTGAGG - Exonic
1007790721 6:44306669-44306691 GAACTGGTTTCCCTGTAGGGTGG + Intronic
1013781785 6:113736524-113736546 GCAGTTGGTTGCCTGTGGGCAGG - Intergenic
1014679891 6:124415452-124415474 GCATGTGGGTTCCTGGAGGGTGG - Intronic
1015389029 6:132660491-132660513 GGATCTGGTTCCATGTAGAGAGG - Intergenic
1015814159 6:137191075-137191097 GCTGGGGGTTCCCTGTAGGGCGG + Intergenic
1018055653 6:160050049-160050071 GCATTTGGTTCCCTGTAGGGAGG + Intronic
1021668569 7:23013330-23013352 GTCTTTGGTCCCCTGCAGGGCGG - Intronic
1022498057 7:30865545-30865567 GAATTTGGTTCCCTGTAAAGGGG - Intronic
1026978141 7:74511265-74511287 TCTTTTGGTGACCTGTAGGGAGG + Intronic
1030440658 7:109584336-109584358 CAATCTGGTTCCCTGAAGGGAGG - Intergenic
1035375145 7:158402730-158402752 GCCCTTGGATCCCTCTAGGGCGG - Intronic
1039573310 8:38603905-38603927 GCCTTTGGCTCCCTCCAGGGAGG + Intergenic
1042808778 8:72801085-72801107 GCATTATGTTCCCTGGAGTGGGG - Intronic
1049358832 8:142202223-142202245 GCATTTGACTCCCCGCAGGGAGG + Intergenic
1052388620 9:27851834-27851856 TAATTGGGTTCCCTGCAGGGAGG - Intergenic
1057677011 9:97143824-97143846 GCAGTAGGTTGACTGTAGGGTGG - Intergenic
1059092420 9:111374034-111374056 GCTTTTGTAACCCTGTAGGGTGG - Exonic
1059136040 9:111807413-111807435 TCATTTTGCTCCTTGTAGGGAGG + Intergenic
1203632979 Un_KI270750v1:86230-86252 GCATTTCTTTACCTTTAGGGTGG + Intergenic
1186269030 X:7865149-7865171 CCATTTGGTTGCCTGGGGGGAGG + Intergenic
1201610672 Y:15839778-15839800 GCCTTTGGGTGCCAGTAGGGAGG + Intergenic