ID: 1018057498

View in Genome Browser
Species Human (GRCh38)
Location 6:160065067-160065089
Sequence ACAGCAGCTCCAGGTGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057498_1018057504 -8 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057504 6:160065082-160065104 GCTGCTGTGGTGACTGCATGGGG 0: 1
1: 1
2: 4
3: 22
4: 285
1018057498_1018057502 -10 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057502 6:160065080-160065102 GAGCTGCTGTGGTGACTGCATGG 0: 1
1: 0
2: 0
3: 27
4: 292
1018057498_1018057506 -3 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057506 6:160065087-160065109 TGTGGTGACTGCATGGGGAAGGG 0: 1
1: 0
2: 2
3: 36
4: 347
1018057498_1018057507 2 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345
1018057498_1018057508 20 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057508 6:160065110-160065132 ATTGGAGCTGAAGCAGAGAGTGG 0: 1
1: 0
2: 2
3: 38
4: 423
1018057498_1018057503 -9 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057503 6:160065081-160065103 AGCTGCTGTGGTGACTGCATGGG 0: 1
1: 0
2: 2
3: 18
4: 242
1018057498_1018057509 28 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1018057498_1018057505 -4 Left 1018057498 6:160065067-160065089 CCGTCACCACCTGGAGCTGCTGT 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1018057505 6:160065086-160065108 CTGTGGTGACTGCATGGGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057498 Original CRISPR ACAGCAGCTCCAGGTGGTGA CGG (reversed) Intronic