ID: 1018057500

View in Genome Browser
Species Human (GRCh38)
Location 6:160065073-160065095
Sequence GTCACCACAGCAGCTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 396}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057500_1018057508 14 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057508 6:160065110-160065132 ATTGGAGCTGAAGCAGAGAGTGG 0: 1
1: 0
2: 2
3: 38
4: 423
1018057500_1018057506 -9 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057506 6:160065087-160065109 TGTGGTGACTGCATGGGGAAGGG 0: 1
1: 0
2: 2
3: 36
4: 347
1018057500_1018057509 22 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1018057500_1018057505 -10 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057505 6:160065086-160065108 CTGTGGTGACTGCATGGGGAAGG 0: 1
1: 0
2: 3
3: 52
4: 303
1018057500_1018057507 -4 Left 1018057500 6:160065073-160065095 CCACCTGGAGCTGCTGTGGTGAC 0: 1
1: 0
2: 2
3: 32
4: 396
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057500 Original CRISPR GTCACCACAGCAGCTCCAGG TGG (reversed) Intronic