ID: 1018057501

View in Genome Browser
Species Human (GRCh38)
Location 6:160065076-160065098
Sequence GCAGTCACCACAGCAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018057501_1018057508 11 Left 1018057501 6:160065076-160065098 CCTGGAGCTGCTGTGGTGACTGC 0: 1
1: 0
2: 2
3: 38
4: 336
Right 1018057508 6:160065110-160065132 ATTGGAGCTGAAGCAGAGAGTGG 0: 1
1: 0
2: 2
3: 38
4: 423
1018057501_1018057509 19 Left 1018057501 6:160065076-160065098 CCTGGAGCTGCTGTGGTGACTGC 0: 1
1: 0
2: 2
3: 38
4: 336
Right 1018057509 6:160065118-160065140 TGAAGCAGAGAGTGGACCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1018057501_1018057507 -7 Left 1018057501 6:160065076-160065098 CCTGGAGCTGCTGTGGTGACTGC 0: 1
1: 0
2: 2
3: 38
4: 336
Right 1018057507 6:160065092-160065114 TGACTGCATGGGGAAGGGATTGG 0: 1
1: 0
2: 6
3: 24
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018057501 Original CRISPR GCAGTCACCACAGCAGCTCC AGG (reversed) Intronic